Target Regulator(s) Information (MicroRNA)

Content Navigation (  All   None )                                      
Target General Information
The microRNAs (miRNAs) Regulating This Target
References
Target General Information  Top
Target ID T68547 Target Info
Target Name Histone deacetylase 1 (HDAC1)
Synonyms RPD3L1; HD1
Target Type Successful Target
Gene Name HDAC1
Biochemical Class Carbon-nitrogen hydrolase
UniProt ID
Q13547
The microRNAs (miRNAs) Regulating This Target  Top
miRNA Mature ID hsa-miR-34a-5p miRNA Info
miRNA Mature AC
MIMAT0000255
Sequence uggcagugucuuagcugguugu
miRNA Species Homo sapiens
Regulation Mechanism HDAC1 depletion inhibits the metastatic abilities of gastric cancer cells by regulating the miRNA-34a pathway, which may be a potential target for the treatment of gastric cancer. [4]
Evidence Score (E-score) 4 +
1 Immunofluorescence; Microarray; qRT-PCR; Western Blot [1]
2 Luciferase Reporter Assay; qRT-PCR; Western Blot [2]
3 Luciferase Reporter Assay; qRT-PCR; Western Blot [3]
4 Reporter Assay [4]
Representative Target(s) Regulated by This miRNA Amphiregulin (AREG) Target Info
AREG_HUMAN
Androgen receptor (AR) Target Info
ANDR_HUMAN
miRNA Mature ID hsa-miR-449a miRNA Info
miRNA Mature AC
MIMAT0001541
Sequence uggcaguguauuguuagcuggu
miRNA Species Homo sapiens
Regulation Mechanism HDAC-1 proved to be sensitive to miR-449a and a significant decrease (72%) in HDAC-1 protein levels was detected in miR-449a-transfected cells. [8]
Evidence Score (E-score) 4 +
1 Immunoblot [5]
2 Luciferase Reporter Assay [6]
3 Luciferase Reporter Assay; Western Blot [7]
4 Luciferase Reporter Assay; Western Blot [8]
Representative Target(s) Regulated by This miRNA Apoptosis regulator Bcl-2 (BCL-2) Target Info
BCL2_HUMAN
Cyclin-dependent kinase 4 (CDK4) Target Info
CDK4_HUMAN
miRNA Mature ID hsa-miR-874-3p miRNA Info
miRNA Mature AC
MIMAT0004911
Sequence cugcccuggcccgagggaccga
miRNA Species Homo sapiens
Evidence Score (E-score) 2 +
1 Dual Luciferase Reporter Assay; Western Blot [9]
2 Luciferase Reporter Assay; Western Blot [10]
Representative Target(s) Regulated by This miRNA Cyclin-dependent kinase 9 (CDK9) Target Info
CDK9_HUMAN
Histone deacetylase 1 (HDAC1) Target Info
HDAC1_HUMAN
miRNA Mature ID hsa-miR-449b-5p miRNA Info
miRNA Mature AC
MIMAT0003327
Sequence aggcaguguauuguuagcuggc
miRNA Species Homo sapiens
Regulation Mechanism Direct interaction of miR-449 with the target gene HDAC1 3'UTR was confirmed. [7]
Evidence Score (E-score) 1 +
1 Luciferase Reporter Assay; Western Blot [7]
Representative Target(s) Regulated by This miRNA Cyclin-dependent kinase 4 (CDK4) Target Info
CDK4_HUMAN
Cyclin-dependent kinase 6 (CDK6) Target Info
CDK6_HUMAN
miRNA Mature ID hsa-miR-520h miRNA Info
miRNA Mature AC
MIMAT0002867
Sequence acaaagugcuucccuuuagagu
miRNA Species Homo sapiens
Regulation Mechanism Doxorubicin specifically downregulates HDAC1 protein expression and identified HDAC1 as a target of miR-520h, which was upregulated by doxorubicin. [11]
Evidence Score (E-score) 1 +
1 Luciferase Reporter Assay; Western Blot [11]
Representative Target(s) Regulated by This miRNA ATP-binding cassette transporter G2 (ABCG2) Target Info
ABCG2_HUMAN
Histone deacetylase 1 (HDAC1) Target Info
HDAC1_HUMAN
References  Top
REF 1 Depletion of histone deacetylase 1 inhibits metastatic abilities of gastric cancer cells by regulating the miR-34a/CD44 pathway. Oncol Rep. 2015 Aug;34(2):663-72.
REF 2 miR-34a regulates HDAC1 expression to affect the proliferation and apoptosis of hepatocellular carcinoma. Am J Transl Res. 2017 Jan 15;9(1):103-114.
REF 3 TP53-independent function of miR-34a via HDAC1 and p21(CIP1/WAF1.). Mol Ther. 2013 Sep;21(9):1678-86.
REF 4 Genome-wide characterization of miR-34a induced changes in protein and mRNA expression by a combined pulsed SILAC and microarray analysis. Mol Cell Proteomics. 2011 Aug;10(8):M111.010462.
REF 5 miR-449a causes Rb-dependent cell cycle arrest and senescence in prostate cancer cells. Oncotarget. 2010 Sep;1(5):349-58.
REF 6 Epigenetic silencing of HDAC1 by miR-449a upregulates Runx2 and promotes osteoblast differentiation. Int J Mol Med. 2015 Jan;35(1):238-46.
REF 7 miR-449 inhibits cell proliferation and is down-regulated in gastric cancer. Mol Cancer. 2011 Mar 18;10:29.
REF 8 miR-449a targets HDAC-1 and induces growth arrest in prostate cancer. Oncogene. 2009 Apr 9;28(14):1714-24.
REF 9 MicroRNA 874-3p Exerts Skeletal Anabolic Effects Epigenetically during Weaning by Suppressing Hdac1 Expression. J Biol Chem. 2016 Feb 19;291(8):3959-66.
REF 10 Tumour-suppressive microRNA-874 contributes to cell proliferation through targeting of histone deacetylase 1 in head and neck squamous cell carcinoma. Br J Cancer. 2013 Apr 30;108(8):1648-58.
REF 11 Downregulation of histone deacetylase 1 by microRNA-520h contributes to the chemotherapeutic effect of doxorubicin. FEBS Lett. 2014 Jan 3;588(1):184-91.

If You Find Any Error in Data or Bug in Web Service, Please Kindly Report It to Dr. Zhou and Dr. Zhang.