The microRNAs (miRNAs) Regulating This Target |
Top |
miRNA Mature ID |
hsa-miR-10b-5p |
miRNA Info
|
miRNA Mature AC |
|
Sequence |
uacccuguagaaccgaauuugug
|
miRNA Species |
Homo sapiens |
Regulation Mechanism |
Co-transfection of the luciferase reporter system containing the wild type 3'UTR of PIK3CA with miR-10b in HEK293T cells resulted in significant loss of luciferase reporter expression. |
[1] |
Evidence Score (E-score) |
2 |
+ |
1 |
Luciferase Reporter Assay; Western Blot |
[1] |
2 |
Western Blot |
[2] |
Representative Target(s) Regulated by This miRNA |
Cellular tumor antigen p53 (TP53)
|
Target Info
|
|
Cyclic AMP-responsive element-binding protein (CREB1)
|
Target Info
|
|
miRNA Mature ID |
hsa-miR-148b-3p |
miRNA Info
|
miRNA Mature AC |
|
Sequence |
ucagugcaucacagaacuuugu
|
miRNA Species |
Homo sapiens |
Regulation Mechanism |
miR-148b is a major coordinator of breast cancer progression in a relapse-associated microRNA signature by targeting ITGA5. |
[3] |
Evidence Score (E-score) |
2 |
+ |
1 |
Luciferase Reporter Assay |
[3] |
2 |
Western Blot |
[4] |
Representative Target(s) Regulated by This miRNA |
Activated leukocyte cell adhesionmolecule (ALCAM)
|
Target Info
|
|
Activin receptor-like kinase 2 (ALK-2)
|
Target Info
|
|
miRNA Mature ID |
hsa-miR-203a-3p |
miRNA Info
|
miRNA Mature AC |
|
Sequence |
gugaaauguuuaggaccacuag
|
miRNA Species |
Homo sapiens |
Regulation Mechanism |
miR-203 overexpression also inhibited the protein expression of phosphoinositide 3-kinase catalytic subunit alpha (PIK3CA), a direct target of miR-203. |
[6] |
Evidence Score (E-score) |
2 |
+ |
1 |
Luciferase Reporter Assay; qRT-PCR; Western Blot |
[5] |
2 |
Luciferase Reporter Assay; Western Blot |
[6] |
Representative Target(s) Regulated by This miRNA |
Apoptosis inhibitor survivin (BIRC5)
|
Target Info
|
|
Apoptosis regulator Bcl-W (BCL-W)
|
Target Info
|
|
miRNA Mature ID |
hsa-miR-139-5p |
miRNA Info
|
miRNA Mature AC |
|
Sequence |
ucuacagugcacgugucuccagu
|
miRNA Species |
Homo sapiens |
Evidence Score (E-score) |
1 |
+ |
1 |
Luciferase Reporter Assay |
[7] |
Representative Target(s) Regulated by This miRNA |
Apoptosis regulator Bcl-2 (BCL-2)
|
Target Info
|
|
C-X-C chemokine receptor type 4 (CXCR4)
|
Target Info
|
|
miRNA Mature ID |
hsa-miR-19a-3p |
miRNA Info
|
miRNA Mature AC |
|
Sequence |
ugugcaaaucuaugcaaaacuga
|
miRNA Species |
Homo sapiens |
Regulation Mechanism |
Luciferase activity was significantly repressed in the miR-19a mimic transfectant and miR-19a-mediated repression of luciferase activity was abolished by the mutant-type 3'UTR of PIK3CA. |
[8] |
Evidence Score (E-score) |
1 |
+ |
1 |
In Situ Hybridization; Luciferase Reporter Assay; Western Blot |
[8] |
Representative Target(s) Regulated by This miRNA |
Adrenergic receptor beta-1 (ADRB1)
|
Target Info
|
|
Apoptosis signal-regulating kinase 1 (MAP3K5)
|
Target Info
|
|
miRNA Mature ID |
hsa-miR-373-3p |
miRNA Info
|
miRNA Mature AC |
|
Sequence |
gaagugcuucgauuuuggggugu
|
miRNA Species |
Homo sapiens |
Regulation Mechanism |
miR-373 targets directly the PIK3CA transcript. |
[9] |
Evidence Score (E-score) |
1 |
+ |
1 |
Western Blot; Luciferase Reporter Assay; Microarray |
[9] |
Representative Target(s) Regulated by This miRNA |
B-cell translocation gene 1 protein (BTG1)
|
Target Info
|
|
Cell surface protein HB15 (CD83)
|
Target Info
|
|
miRNA Mature ID |
hsa-miR-422a |
miRNA Info
|
miRNA Mature AC |
|
Sequence |
acuggacuuagggucagaaggc
|
miRNA Species |
Homo sapiens |
Regulation Mechanism |
Luciferase activity with PIK3CA-3'TR WT decreased by after co-transfection with miR-422a mimics and increased after co-transfection with miR-422a inhibitor. |
[10] |
Evidence Score (E-score) |
1 |
+ |
1 |
Luciferase Reporter Assay; Western Blot |
[10] |
Representative Target(s) Regulated by This miRNA |
Ecto-5'-nucleotidase (CD73)
|
Target Info
|
|
Forkhead box protein Q1 (FOXQ1)
|
Target Info
|
|
miRNA Mature ID |
hsa-miR-490-5p |
miRNA Info
|
miRNA Mature AC |
|
Sequence |
ccauggaucuccaggugggu
|
miRNA Species |
Homo sapiens |
Regulation Mechanism |
miR-490-5p directly binds to 3'UTR of the PIK3CA mRNA and reduce the expression of PIK3CA at both mRNA and protein levels, which further inhibits phosphatidylinositol 3-kinase/Akt signalling pathway. |
[11] |
Evidence Score (E-score) |
1 |
+ |
1 |
Luciferase Reporter Assay |
[11] |
Representative Target(s) Regulated by This miRNA |
Bone morphogenetic protein receptor (BMPR2)
|
Target Info
|
|
PI3-kinase alpha (PIK3CA)
|
Target Info
|
|