Target Regulator(s) Information (MicroRNA)

Content Navigation (  All   None )                                      
Target General Information
The microRNAs (miRNAs) Regulating This Target
References
Target General Information  Top
Target ID T81443 Target Info
Target Name Toll-like receptor 4 (TLR4)
Synonyms TLR-4; HToll; CD284
Target Type Clinical trial Target
Gene Name TLR4
Biochemical Class Toll-like receptor
UniProt ID
O00206
The microRNAs (miRNAs) Regulating This Target  Top
miRNA Mature ID hsa-miR-146a-5p miRNA Info
miRNA Mature AC
MIMAT0000449
Sequence ugagaacugaauuccauggguu
miRNA Species Homo sapiens
Regulation Mechanism Toll-like receptor 4 is a relevant target of miR-146a. [1]
Evidence Score (E-score) 2 +
1 ELISA; Luciferase Reporter Assay; Western Blot [1]
2 Western Blot; RT-PCR [2]
Representative Target(s) Regulated by This miRNA Activation B7-1 antigen (CD80) Target Info
CD80_HUMAN
Apoptosis mediating surface antigen FAS (FAS) Target Info
TNR6_HUMAN
miRNA Mature ID hsa-miR-146b-5p miRNA Info
miRNA Mature AC
MIMAT0002809
Sequence ugagaacugaauuccauaggcug
miRNA Species Homo sapiens
Evidence Score (E-score) 2 +
1 Luciferase Reporter Assay; qRT-PCR [3]
2 Luciferase Reporter Assay; qRT-PCR [4]
Representative Target(s) Regulated by This miRNA Calgranulin D (S100A12) Target Info
S10AC_HUMAN
DNA-binding factor KBF1 (p105) Target Info
NFKB1_HUMAN
miRNA Mature ID hsa-miR-181b-2-3p miRNA Info
miRNA Mature AC
MIMAT0031893
Sequence cucacugaucaaugaaugca
miRNA Species Homo sapiens
Regulation Mechanism The 3'UTR of TLR4 combined with miR-181b was verified by a dual-luciferase reporter assay. [5]
Evidence Score (E-score) 2 +
1 Luciferase Reporter Assay; Western Blot [5]
2 Luciferase Reporter Assay; Western Blot [6]
Representative Target(s) Regulated by This miRNA Toll-like receptor 4 (TLR4) Target Info
TLR4_HUMAN
miRNA Mature ID hsa-let-7b-5p miRNA Info
miRNA Mature AC
MIMAT0000063
Sequence ugagguaguagguugugugguu
miRNA Species Homo sapiens
Regulation Mechanism Let-7b targets the specific sites of TLR4 mRNA. [7]
Evidence Score (E-score) 1 +
1 Luciferase Reporter Assay [7]
Representative Target(s) Regulated by This miRNA Activin receptor-like kinase 2 (ALK-2) Target Info
ACVR1_HUMAN
CDK inhibitor 1B p27Kip1 (CDKN1B) Target Info
CDN1B_HUMAN
miRNA Mature ID hsa-let-7i-5p miRNA Info
miRNA Mature AC
MIMAT0000415
Sequence ugagguaguaguuugugcuguu
miRNA Species Homo sapiens
Regulation Mechanism The overexpression of let-7i-5p by mature miRNA precursor transfection resulted in the unchanged mRNA level of target TLR4; The Underexpression by 2'-O-Me Antisense miRNA Oligonucleotides resulted in the increased protein level of target TLR4. [4]
Evidence Score (E-score) 1 +
1 Luciferase Reporter Assay; qRT-PCR; Western Blot [4]
Representative Target(s) Regulated by This miRNA Aurora kinase B (AURKB) Target Info
AURKB_HUMAN
Bone morphogenetic protein 4 (BMP4) Target Info
BMP4_HUMAN
miRNA Mature ID hsa-miR-26b-5p miRNA Info
miRNA Mature AC
MIMAT0000083
Sequence uucaaguaauucaggauaggu
miRNA Species Homo sapiens
Regulation Mechanism miR-26b mimic decreased the relative luciferase activity of TLR4 3'UTR and miR-26b inhibitor increased its relative luciferase activity. [8]
Evidence Score (E-score) 1 +
1 Luciferase Reporter Assay [8]
Representative Target(s) Regulated by This miRNA ATP-binding cassette transporter A1 (ABCA1) Target Info
ABCA1_HUMAN
Collagen I (COL1A2) Target Info
CO1A2_HUMAN
References  Top
REF 1 MiR-146a inhibits oxidized low-density lipoprotein-induced lipid accumulation and inflammatory response via targeting toll-like receptor 4. FEBS Lett. 2011 Mar 23;585(6):854-60.
REF 2 miR-146a Attenuates Inflammatory Pathways Mediated by TLR4/NF-B and TNFalpha to Protect Primary Human Retinal Microvascular Endothelial Cells Grown in... Mediators Inflamm. 2016;2016:3958453.
REF 3 Negative regulation of Toll-like receptor 4 signaling by IL-10-dependent microRNA-146b. Proc Natl Acad Sci U S A. 2013 Jul 9;110(28):11499-504.
REF 4 A cellular micro-RNA, let-7i, regulates Toll-like receptor 4 expression and contributes to cholangiocyte immune responses against Cryptosporidium parvum infection. J Biol Chem. 2007 Sep 28;282(39):28929-38.
REF 5 MicroRNA-181b negatively regulates the proliferation of human epidermal keratinocytes in psoriasis through targeting TLR4. J Cell Mol Med. 2017 Feb;21(2):278-285.
REF 6 Downregulation of TLR4 by miR-181a Provides Negative Feedback Regulation to Lipopolysaccharide-Induced Inflammation. Front Pharmacol. 2018 Feb 26;9:142.
REF 7 Let-7b is involved in the inflammation and immune responses associated with Helicobacter pylori infection by targeting Toll-like receptor 4. PLoS One. 2013;8(2):e56709.
REF 8 Respiratory syncytial virus infection inhibits TLR4 signaling via up-regulation of miR-26b. Cell Biol Int. 2015 Dec;39(12):1376-83.

If You Find Any Error in Data or Bug in Web Service, Please Kindly Report It to Dr. Zhou and Dr. Zhang.