Target Regulator(s) Information (MicroRNA)

Content Navigation (  All   None )                                      
Target General Information
The microRNAs (miRNAs) Regulating This Target
References
Target General Information  Top
Target ID T85289 Target Info
Target Name Cysteine-rich angiogenic inducer 61 (CYR61)
Synonyms CCN1
Target Type Literature-reported Target
Gene Name CYR61
UniProt ID
O00622
The microRNAs (miRNAs) Regulating This Target  Top
miRNA Mature ID hsa-miR-155-5p miRNA Info
miRNA Mature AC
MIMAT0000646
Sequence uuaaugcuaaucgugauaggggu
miRNA Species Homo sapiens
Evidence Score (E-score) 3 +
1 Luciferase Reporter Assay; qRT-PCR; Western Blot [1]
2 Luciferase Reporter Assay; qRT-PCR; Western Blot [2]
3 Microarray; qRT-PCR; Luciferase Reporter Assay; Western Blot [3]
Representative Target(s) Regulated by This miRNA Acetyl-CoA transporter (SLC33A1) Target Info
ACATN_HUMAN
Angiotensin II receptor type-1 (AGTR1) Target Info
AGTR1_HUMAN
miRNA Mature ID hsa-miR-100-5p miRNA Info
miRNA Mature AC
MIMAT0000098
Sequence aacccguagauccgaacuugug
miRNA Species Homo sapiens
Regulation Mechanism miR-100 directly targets the Cyr61 in osteosarcoma cells. [4]
Evidence Score (E-score) 2 +
1 ELISA; Luciferase Reporter Assay; Western Blot [4]
2 Western Blot [4]
Representative Target(s) Regulated by This miRNA ATM serine/threonine kinase (ATM) Target Info
ATM_HUMAN
Bone morphogenetic protein receptor (BMPR2) Target Info
BMPR2_HUMAN
miRNA Mature ID hsa-miR-22-3p miRNA Info
miRNA Mature AC
MIMAT0000077
Sequence aagcugccaguugaagaacugu
miRNA Species Homo sapiens
Regulation Mechanism miR-22 directly targeted the 3'-untranslated region of Cyr61 messenger RNA and inhibited Cyr61 expression. [5]
Evidence Score (E-score) 2 +
1 Luciferase Reporter Assay; Western Blot [5]
2 Western Blot [5]
Representative Target(s) Regulated by This miRNA 5-HT 2C receptor (HTR2C) Target Info
5HT2C_HUMAN
ATP-citrate synthase (ACLY) Target Info
ACLY_HUMAN
miRNA Mature ID hsa-miR-205-5p miRNA Info
miRNA Mature AC
MIMAT0000266
Sequence uccuucauuccaccggagucug
miRNA Species Homo sapiens
Regulation Mechanism miR-205 binds site predictions of CYR61 by RNAhybrid. [6]
Evidence Score (E-score) 1 +
1 Western Blot [6]
Representative Target(s) Regulated by This miRNA Androgen receptor (AR) Target Info
ANDR_HUMAN
Apoptosis regulator Bcl-2 (BCL-2) Target Info
BCL2_HUMAN
miRNA Mature ID hsa-miR-30a-3p miRNA Info
miRNA Mature AC
MIMAT0000088
Sequence cuuucagucggauguuugcagc
miRNA Species Homo sapiens
Regulation Mechanism The downregulation of miR-30a-3p by siRNA Transfection resulted in the increased protein level of target CRY61. [2]
Evidence Score (E-score) 1 +
1 Luciferase Reporter Assay; qRT-PCR; Western Blot [2]
Representative Target(s) Regulated by This miRNA Beclin-1 (BECN1) Target Info
BECN1_HUMAN
Cyclic-AMP-dependent transcription factor ATF-3 (ATF3) Target Info
ATF3_HUMAN
miRNA Mature ID hsa-miR-634 miRNA Info
miRNA Mature AC
MIMAT0003304
Sequence aaccagcaccccaacuuuggac
miRNA Species Homo sapiens
Evidence Score (E-score) 1 +
1 Luciferase Reporter Assay; Western Blot [3]
Representative Target(s) Regulated by This miRNA Cysteine-rich angiogenic inducer 61 (CYR61) Target Info
CYR61_HUMAN
References  Top
REF 1 MicroRNA-155 contributes to preeclampsia by down-regulating CYR61. Am J Obstet Gynecol. 2010 May;202(5):466.e1-7.
REF 2 Physiological identification of human transcripts translationally regulated by a specific microRNA. Hum Mol Genet. 2005 Dec 15;14(24):3813-21.
REF 3 Differential Effects of MicroRNAs on Glioblastoma Growth and Migration. Genes (Basel). 2013 Mar 4;4(1):46-64.
REF 4 MicroRNA-100 inhibits osteosarcoma cell proliferation by targeting Cyr61. Tumour Biol. 2014 Feb;35(2):1095-100.
REF 5 A novel p53/microRNA-22/Cyr61 axis in synovial cells regulates inflammation in rheumatoid arthritis. Arthritis Rheumatol. 2014 Jan;66(1):49-59.
REF 6 miR-205 expression promotes cell proliferation and migration of human cervical cancer cells. PLoS One. 2012;7(10):e46990.

If You Find Any Error in Data or Bug in Web Service, Please Kindly Report It to Dr. Zhou and Dr. Zhang.