Target Regulator(s) Information (MicroRNA)

Content Navigation (  All   None )                                      
Target General Information
The microRNAs (miRNAs) Regulating This Target
References
Target General Information  Top
Target ID T87024 Target Info
Target Name Amyloid beta A4 protein (APP)
Synonyms Protease nexin-II; PreA4; PN-II; Cerebral vascular amyloid peptide; CVAP; Amyloid-beta precursor protein; Amyloid-beta A4 protein; Alzheimer disease amyloid protein; APPI; APP; AD1; ABPP; A4
Target Type Successful Target
Gene Name APP
Biochemical Class Amyloid beta-protein peptide
UniProt ID
P05067
The microRNAs (miRNAs) Regulating This Target  Top
miRNA Mature ID hsa-miR-106a-5p miRNA Info
miRNA Mature AC
MIMAT0000103
Sequence aaaagugcuuacagugcagguag
miRNA Species Homo sapiens
Regulation Mechanism The overexpression of miR-106a-5p resulted in the decreased protein level of target APP. [2]
Evidence Score (E-score) 2 +
1 Luciferase Reporter Assay [1]
2 Luciferase Reporter Assay [2]
Representative Target(s) Regulated by This miRNA Amyloid beta A4 protein (APP) Target Info
A4_HUMAN
Apoptosis mediating surface antigen FAS (FAS) Target Info
TNR6_HUMAN
miRNA Mature ID hsa-miR-106b-5p miRNA Info
miRNA Mature AC
MIMAT0000680
Sequence uaaagugcugacagugcagau
miRNA Species Homo sapiens
Regulation Mechanism Transfection with complementary anti-miR-106b oligonucleotides caused a significant increase in luciferase expression which indicating that miR-106b bound directly and specifically to the 3'UTR of APP. [3]
Evidence Score (E-score) 2 +
1 Luciferase Reporter Assay; Western Blot [1]
2 Luciferase Reporter Assay; Western Blot [3]
Representative Target(s) Regulated by This miRNA Amyloid beta A4 protein (APP) Target Info
A4_HUMAN
Apoptosis mediating surface antigen FAS (FAS) Target Info
TNR6_HUMAN
miRNA Mature ID hsa-miR-144-3p miRNA Info
miRNA Mature AC
MIMAT0000436
Sequence uacaguauagaugauguacu
miRNA Species Homo sapiens
Evidence Score (E-score) 2 +
1 Luciferase Reporter Assay; qRT-PCR [4]
2 PAR-CLIP [5]
Representative Target(s) Regulated by This miRNA ADAM metallopeptidase with thrombospondin 1 (ADAMTS1) Target Info
ATS1_HUMAN
Amyloid beta A4 protein (APP) Target Info
A4_HUMAN
miRNA Mature ID hsa-miR-17-5p miRNA Info
miRNA Mature AC
MIMAT0000070
Sequence caaagugcuuacagugcagguag
miRNA Species Homo sapiens
Regulation Mechanism Transfection with complementary anti-miR-17 oligonucleotides caused a significant increase in luciferase expression which indicating that miR-17 bound directly and specifically to the 3'UTR of APP. [6]
Evidence Score (E-score) 2 +
1 Luciferase Reporter Assay; Western Blot [1]
2 Luciferase Reporter Assay; Western Blot [6]
Representative Target(s) Regulated by This miRNA Amyloid beta A4 protein (APP) Target Info
A4_HUMAN
Apoptosis mediating surface antigen FAS (FAS) Target Info
TNR6_HUMAN
miRNA Mature ID hsa-miR-20a-5p miRNA Info
miRNA Mature AC
MIMAT0000075
Sequence uaaagugcuuauagugcagguag
miRNA Species Homo sapiens
Regulation Mechanism Transfection with complementary anti-miR-20a oligonucleotides caused a significant increase in luciferase expression which indicating that miR-20a bound directly and specifically to the 3'UTR of APP. [1]
Evidence Score (E-score) 2 +
1 GFP Reporter Assay; qRT-PCR; Western Blot [7]
2 Luciferase Reporter Assay; Western Blot [1]
Representative Target(s) Regulated by This miRNA Amyloid beta A4 protein (APP) Target Info
A4_HUMAN
Apoptosis regulator Bcl-2 (BCL-2) Target Info
BCL2_HUMAN
miRNA Mature ID hsa-let-7d-5p miRNA Info
miRNA Mature AC
MIMAT0000065
Sequence agagguaguagguugcauaguu
miRNA Species Homo sapiens
Evidence Score (E-score) 1 +
1 Luciferase Reporter Assay [1]
Representative Target(s) Regulated by This miRNA Amyloid beta A4 protein (APP) Target Info
A4_HUMAN
Divalent metal transporter 1 (SLC11A2) Target Info
NRAM2_HUMAN
miRNA Mature ID hsa-miR-130a-3p miRNA Info
miRNA Mature AC
MIMAT0000425
Sequence cagugcaauguuaaaagggcau
miRNA Species Homo sapiens
Regulation Mechanism Transfection with complementary anti-miR-130a oligonucleotides caused a significant increase in luciferase expression which indicating that miR-130a bound directly and specifically to the 3'UTR of APP. [1]
Evidence Score (E-score) 1 +
1 Luciferase Reporter Assay [1]
Representative Target(s) Regulated by This miRNA Activin receptor-like kinase 2 (ALK-2) Target Info
ACVR1_HUMAN
Amyloid beta A4 protein (APP) Target Info
A4_HUMAN
miRNA Mature ID hsa-miR-15a-5p miRNA Info
miRNA Mature AC
MIMAT0000068
Sequence uagcagcacauaaugguuugug
miRNA Species Homo sapiens
Regulation Mechanism Transfection with complementary anti-miR-15a oligonucleotides caused a significant increase in luciferase expression which indicating that miR-15a bound directly and specifically to the 3'UTR of APP. [1]
Evidence Score (E-score) 1 +
1 Luciferase Reporter Assay [1]
Representative Target(s) Regulated by This miRNA Amyloid beta A4 protein (APP) Target Info
A4_HUMAN
Apoptosis regulator Bcl-2 (BCL-2) Target Info
BCL2_HUMAN
miRNA Mature ID hsa-miR-520c-3p miRNA Info
miRNA Mature AC
MIMAT0002846
Sequence aaagugcuuccuuuuagagggu
miRNA Species Homo sapiens
Regulation Mechanism The overexpression of miR-520c-3p resulted in the decreased protein level of target APP. [2]
Evidence Score (E-score) 1 +
1 Luciferase Reporter Assay; Western Blot; qRT-PCR [2]
Representative Target(s) Regulated by This miRNA Amyloid beta A4 protein (APP) Target Info
A4_HUMAN
Extracellular matrix receptor III (CD44) Target Info
CD44_HUMAN
References  Top
REF 1 MicroRNA regulation of Alzheimer's Amyloid precursor protein expression. Neurobiol Dis. 2009 Mar;33(3):422-8.
REF 2 MicroRNAs can regulate human APP levels. Mol Neurodegener. 2008 Aug 6;3:10.
REF 3 MicroRNAs in the miR-106b family regulate p21/CDKN1A and promote cell cycle progression. Mol Cell Biol. 2008 Apr;28(7):2167-74.
REF 4 MiR-144-3p and Its Target Gene -Amyloid Precursor Protein Regulate 1-Methyl-4-Phenyl-1,2-3,6-Tetrahydropyridine-Induced Mitochondrial Dysfunction. Mol Cells. 2016 Jul;39(7):543-9.
REF 5 A quantitative analysis of CLIP methods for identifying binding sites of RNA-binding proteins. Nat Methods. 2011 May 15;8(7):559-64.
REF 6 The effect of central loops in miRNA:MRE duplexes on the efficiency of miRNA-mediated gene regulation. PLoS One. 2008 Mar 5;3(3):e1719.
REF 7 miR-20a promotes proliferation and invasion by targeting APP in human ovarian cancer cells. Acta Biochim Biophys Sin (Shanghai). 2010 May 15;42(5):318-24.

If You Find Any Error in Data or Bug in Web Service, Please Kindly Report It to Dr. Zhou and Dr. Zhang.