Target Regulator(s) Information (MicroRNA)

Content Navigation (  All   None )                                      
Target General Information
The microRNAs (miRNAs) Regulating This Target
References
Target General Information  Top
Target ID T89147 Target Info
Target Name Superoxide dismutase Mn (SOD Mn)
Synonyms Superoxide dismutase [Mn], mitochondrial
Target Type Clinical trial Target
Gene Name SOD2
Biochemical Class Superoxide dismutase/reductase
UniProt ID
P04179
The microRNAs (miRNAs) Regulating This Target  Top
miRNA Mature ID hsa-miR-17-3p miRNA Info
miRNA Mature AC
MIMAT0000071
Sequence acugcagugaaggcacuuguag
miRNA Species Homo sapiens
Regulation Mechanism Transfection with miR-17-3p significantly repressed TNFa-induced SOD2 expression. [1]
Evidence Score (E-score) 2 +
1 Luciferase Reporter Assay; Western Blot [1]
2 qRT-PCR; Western Blot [2]
Representative Target(s) Regulated by This miRNA E-selectin (SELE) Target Info
LYAM2_HUMAN
Integrin alpha-5 (ITGA5) Target Info
ITA5_HUMAN
miRNA Mature ID hsa-miR-222-3p miRNA Info
miRNA Mature AC
MIMAT0000279
Sequence agcuacaucuggcuacugggu
miRNA Species Homo sapiens
Regulation Mechanism The overexpression of miR-222-3p by mature miRNA mimics tranfection resulted in the decreased protein level of target SOD2. [4]
Evidence Score (E-score) 2 +
1 Luciferase Reporter Assay; Microarray; qRT-PCR; Western Blot [3]
2 Luciferase Reporter Assay; Microarray; qRT-PCR; Western Blot [4]
Representative Target(s) Regulated by This miRNA AN1-type zinc finger protein 5 (ZFAND5) Target Info
ZFAN5_HUMAN
ATP-binding cassette transporter G2 (ABCG2) Target Info
ABCG2_HUMAN
miRNA Mature ID hsa-miR-212-3p miRNA Info
miRNA Mature AC
MIMAT0000269
Sequence uaacagucuccagucacggcc
miRNA Species Homo sapiens
Regulation Mechanism SOD was a target of miR-212 and its 3'UTR contained a complementary site for the seed region of miR-212. [5]
Evidence Score (E-score) 1 +
1 Luciferase Reporter Assay [5]
Representative Target(s) Regulated by This miRNA Acetylcholinesterase (AChE) Target Info
ACES_HUMAN
Adenylate cyclase type 1 (ADCY1) Target Info
ADCY1_HUMAN
miRNA Mature ID hsa-miR-377-3p miRNA Info
miRNA Mature AC
MIMAT0000730
Sequence aucacacaaaggcaacuuuugu
miRNA Species Homo sapiens
Regulation Mechanism In a luciferase assay in which the 3 -UTRs of SOD2 were included in the pGL3R vector, miR-377 considerably reduced luciferase activity. [4]
Evidence Score (E-score) 1 +
1 Luciferase Reporter Assay; Western Blot [4]
Representative Target(s) Regulated by This miRNA Cellular tumor antigen p53 (TP53) Target Info
P53_HUMAN
DNA [cytosine-5]-methyltransferase 1 (DNMT1) Target Info
DNMT1_HUMAN
References  Top
REF 1 miR-17* suppresses tumorigenicity of prostate cancer by inhibiting mitochondrial antioxidant enzymes. PLoS One. 2010 Dec 22;5(12):e14356.
REF 2 miR-17-3p Exacerbates Oxidative Damage in Human Retinal Pigment Epithelial Cells. PLoS One. 2016 Aug 9;11(8):e0160887.
REF 3 MicroRNA-222 regulates cell invasion by targeting matrix metalloproteinase 1 (MMP1) and manganese superoxide dismutase 2 (SOD2) in tongue squamous cell carcinoma cell lines. Cancer Genomics Proteomics. 2009 May-Jun;6(3):131-9.
REF 4 MicroRNA-377 is up-regulated and can lead to increased fibronectin production in diabetic nephropathy. FASEB J. 2008 Dec;22(12):4126-35.
REF 5 Genetic and epigenetic down-regulation of microRNA-212 promotes colorectal tumor metastasis via dysregulation of MnSOD. Gastroenterology. 2013 Aug;145(2):426-36.e1-6.

If You Find Any Error in Data or Bug in Web Service, Please Kindly Report It to Dr. Zhou and Dr. Zhang.