Target Regulator(s) Information (MicroRNA)
Target General Information | Top | ||||
---|---|---|---|---|---|
Target ID | T01110 | Target Info | |||
Target Name | Colony stimulating factor-1 receptor (CSF-1R) | ||||
Synonyms | Macrophage colony-stimulating factor 1 receptor | ||||
Target Type | Clinical trial Target | ||||
Gene Name | CSF1R | ||||
UniProt ID |
The microRNAs (miRNAs) Regulating This Target | Top | ||||
---|---|---|---|---|---|
miRNA Mature ID | hsa-miR-155-5p | miRNA Info | |||
miRNA Mature AC | |||||
Sequence | uuaaugcuaaucgugauagggguu | ||||
miRNA Species | Homo sapiens | ||||
Evidence Score (E-score) | 3 | + | |||
Representative Target(s) Regulated by This miRNA | Acetyl-CoA transporter (SLC33A1) | Target Info | |||
Angiotensin II receptor type-1 (AGTR1) | Target Info | ||||
miRNA Mature ID | hsa-miR-22-3p | miRNA Info | |||
miRNA Mature AC | |||||
Sequence | aagcugccaguugaagaacugu | ||||
miRNA Species | Homo sapiens | ||||
Evidence Score (E-score) | 1 | + | |||
Representative Target(s) Regulated by This miRNA | 5-HT 2C receptor (HTR2C) | Target Info | |||
ATP-citrate synthase (ACLY) | Target Info | ||||
miRNA Mature ID | hsa-miR-34a-5p | miRNA Info | |||
miRNA Mature AC | |||||
Sequence | uggcagugucuuagcugguugu | ||||
miRNA Species | Homo sapiens | ||||
Evidence Score (E-score) | 1 | + | |||
Representative Target(s) Regulated by This miRNA | Amphiregulin (AREG) | Target Info | |||
Androgen receptor (AR) | Target Info |
References | Top | ||||
---|---|---|---|---|---|
REF 1 | miR-221 and miR-155 regulate human dendritic cell development, apoptosis, and IL-12 production through targeting of p27kip1, KPC1, and SOCS-1. Blood. 2011 Apr 21;117(16):4293-303. | ||||
REF 2 | MicroRNA-Mediated Down-Regulation of M-CSF Receptor Contributes to Maturation of Mouse Monocyte-Derived Dendritic Cells. Front Immunol. 2013 Oct 30;4:353. | ||||
REF 3 | Transcriptome and targetome analysis in MIR155 expressing cells using RNA-seq. RNA. 2010 Aug;16(8):1610-22. |
If You Find Any Error in Data or Bug in Web Service, Please Kindly Report It to Dr. Zhou and Dr. Zhang.