Target Regulator(s) Information (MicroRNA)

Content Navigation (  All   None )                                      
Target General Information
The microRNAs (miRNAs) Regulating This Target
References
Target General Information  Top
Target ID T15556 Target Info
Target Name Endothelial plasminogen activator inhibitor (SERPINE1)
Synonyms Serpin E1; Plasminogen activator inhibitor type 1; Plasminogen activator inhibitor 1; PLANH1; PAI1; PAI-1
Target Type Clinical trial Target
Gene Name SERPINE1
Biochemical Class Serpin protein
UniProt ID
P05121
The microRNAs (miRNAs) Regulating This Target  Top
miRNA Mature ID hsa-miR-143-3p miRNA Info
miRNA Mature AC
MIMAT0000435
Sequence ugagaugaagcacuguagcuc
miRNA Species Homo sapiens
Evidence Score (E-score) 2 +
1 Luciferase Reporter Assay; Western Blot [1]
2 Luciferase Reporter Assay; Western Blot [2]
Representative Target(s) Regulated by This miRNA Apoptosis regulator Bcl-2 (BCL-2) Target Info
BCL2_HUMAN
Connective tissue growth factor (CTGF) Target Info
CTGF_HUMAN
miRNA Mature ID hsa-miR-145-5p miRNA Info
miRNA Mature AC
MIMAT0000437
Sequence guccaguuuucccaggaaucccu
miRNA Species Homo sapiens
Regulation Mechanism Down-regulated targets in 12Z cells included SERPINE1/PAI-1 was up-regulated upon pre-miR-145 transfection. [3]
Evidence Score (E-score) 2 +
1 Immunoblot; Luciferase Reporter Assay; qRT-PCR; Western Blot [2]
2 qRT-PCR [3]
Representative Target(s) Regulated by This miRNA A proliferation-inducing ligand (APRIL) Target Info
TNF13_HUMAN
Alkaline phosphatase (ALPPL2) Target Info
PPBN_HUMAN
miRNA Mature ID hsa-miR-30b-5p miRNA Info
miRNA Mature AC
MIMAT0000420
Sequence uguaaacauccuacacucagcu
miRNA Species Homo sapiens
Evidence Score (E-score) 2 +
1 GFP Reporter Assay; Luciferase Reporter Assay; Northern Blot; qRT-PCR; Western Blot [4]
2 PAR-CLIP [5]
Representative Target(s) Regulated by This miRNA Apoptosis regulator Bcl-2 (BCL-2) Target Info
BCL2_HUMAN
Beclin-1 (BECN1) Target Info
BECN1_HUMAN
miRNA Mature ID hsa-miR-10a-5p miRNA Info
miRNA Mature AC
MIMAT0000253
Sequence uacccuguagauccgaauuugug
miRNA Species Homo sapiens
Regulation Mechanism SERPINE1 is a direct target gene of miR-10a. [6]
Evidence Score (E-score) 1 +
1 ELISA; Luciferase Reporter Assay; Western Blot [6]
Representative Target(s) Regulated by This miRNA AN1-type zinc finger protein 5 (ZFAND5) Target Info
ZFAN5_HUMAN
Brain-derived neurotrophic factor (BDNF) Target Info
BDNF_HUMAN
miRNA Mature ID hsa-miR-148a-3p miRNA Info
miRNA Mature AC
MIMAT0000243
Sequence ucagugcacuacagaacuuugu
miRNA Species Homo sapiens
Evidence Score (E-score) 1 +
1 Luciferase Reporter Assay [7]
Representative Target(s) Regulated by This miRNA Activated leukocyte cell adhesionmolecule (ALCAM) Target Info
CD166_HUMAN
Activin receptor-like kinase 2 (ALK-2) Target Info
ACVR1_HUMAN
miRNA Mature ID hsa-miR-192-5p miRNA Info
miRNA Mature AC
MIMAT0000222
Sequence cugaccuaugaauugacagcc
miRNA Species Homo sapiens
Regulation Mechanism miR-192 directly regulates SERPINE1 expression. [8]
Evidence Score (E-score) 1 +
1 Luciferase Reporter Assay; Western Blot [8]
Representative Target(s) Regulated by This miRNA Activated leukocyte cell adhesionmolecule (ALCAM) Target Info
CD166_HUMAN
Activin receptor type IIB (ACVR2B) Target Info
AVR2B_HUMAN
miRNA Mature ID hsa-miR-99a-5p miRNA Info
miRNA Mature AC
MIMAT0000097
Sequence aacccguagauccgaucuugug
miRNA Species Homo sapiens
Evidence Score (E-score) 1 +
1 Luciferase Reporter Assay [9]
Representative Target(s) Regulated by This miRNA Endothelial plasminogen activator inhibitor (SERPINE1) Target Info
PAI1_HUMAN
Fibroblast growth factor receptor 3 (FGFR3) Target Info
FGFR3_HUMAN
miRNA Mature ID hsa-miR-301a-3p miRNA Info
miRNA Mature AC
MIMAT0000688
Sequence cagugcaauaguauugucaaagc
miRNA Species Homo sapiens
Evidence Score (E-score) 1 +
1 Luciferase Reporter Assay [9]
Representative Target(s) Regulated by This miRNA Apoptosis signal-regulating kinase 1 (MAP3K5) Target Info
M3K5_HUMAN
Endothelial plasminogen activator inhibitor (SERPINE1) Target Info
PAI1_HUMAN
References  Top
REF 1 PAI-1, a target gene of miR-143, regulates invasion and metastasis by upregulating MMP-13 expression of human osteosarcoma. Cancer Med. 2016 May;5(5):892-902.
REF 2 The miR-143/-145 cluster regulates plasminogen activator inhibitor-1 in bladder cancer. Br J Cancer. 2012 Jan 17;106(2):366-74.
REF 3 MicroRNA miR-145 inhibits proliferation, invasiveness, and stem cell phenotype of an initro endometriosis model by targeting multiple cytoskeletal elements and pluripotency factors. Fertil Steril. 2013 Apr;99(5):1346-1355.e5.
REF 4 miR-30b, down-regulated in gastric cancer, promotes apoptosis and suppresses tumor growth by targeting plasminogen activator inhibitor-1. PLoS One. 2014 Aug 29;9(8):e106049.
REF 5 Genome-wide identification of microRNA targets in human ES cells reveals a role for miR-302 in modulating BMP response.Genes Dev. 2011 Oct 15;25(20):2173-86.
REF 6 MiR-10a and miR-181c regulate collagen type I generation in hypertrophic scars by targeting PAI-1 and uPA. FEBS Lett. 2015 Jan 30;589(3):380-9.
REF 7 Integrative network analysis reveals active microRNAs and their functions in gastric cancer. BMC Syst Biol. 2011 Jun 26;5:99.
REF 8 Early Epigenetic Downregulation of microRNA-192 Expression Promotes Pancreatic Cancer Progression. Cancer Res. 2016 Jul 15;76(14):4149-59.
REF 9 Involvement of miR-30c and miR-301a in immediate induction of plasminogen activator inhibitor-1 by placental growth factor in human pulmonary endothelial cells. Biochem J. 2011 Mar 15;434(3):473-82.

If You Find Any Error in Data or Bug in Web Service, Please Kindly Report It to Dr. Zhou and Dr. Zhang.