Target Regulator(s) Information (MicroRNA)

Content Navigation (  All   None )                                      
Target General Information
The microRNAs (miRNAs) Regulating This Target
References
Target General Information  Top
Target ID T50444 Target Info
Target Name Connective tissue growth factor (CTGF)
Synonyms Long; Insulin-like growth factor-binding protein 8; IGFBP8; IGFBP-8; IGF-binding protein 8; IBP-8; Hypertrophic chondrocyte-specific protein 24; HCS24; CCN2; CCN family member 2
Target Type Clinical trial Target
Gene Name CTGF
UniProt ID
P29279
The microRNAs (miRNAs) Regulating This Target  Top
miRNA Mature ID hsa-miR-133b miRNA Info
miRNA Mature AC
MIMAT0000770
Sequence uuugguccccuucaaccagcua
miRNA Species Homo sapiens
Evidence Score (E-score) 4 +
1 Luciferase Reporter Assay; qRT-PCR; Western Blot [1]
2 Immunohistochemistry; Luciferase Reporter Assay; qRT-PCR; Western Blot [2]
3 Luciferase Reporter Assay [3]
4 PAR-CLIP [4]
Representative Target(s) Regulated by This miRNA Apoptosis mediating surface antigen FAS (FAS) Target Info
TNR6_HUMAN
Apoptosis regulator Bcl-W (BCL-W) Target Info
B2CL2_HUMAN
miRNA Mature ID hsa-miR-18a-5p miRNA Info
miRNA Mature AC
MIMAT0000072
Sequence uaaggugcaucuagugcagauag
miRNA Species Homo sapiens
Regulation Mechanism The downregulation of miR-18a-5p by Anti-miRNA Oligonucleotide resulted in the changed mRNA level of target CTGF. [7]
Evidence Score (E-score) 3 +
1 Luciferase Reporter Assay [5]
2 Luciferase Reporter Assay; qRT-PCR; Western Blot [6]
3 Luciferase Reporter Assay; qRT-PCR; Western Blot [7]
Representative Target(s) Regulated by This miRNA Apoptosis mediating surface antigen FAS (FAS) Target Info
TNR6_HUMAN
Apoptosis regulator Bcl-2 (BCL-2) Target Info
BCL2_HUMAN
miRNA Mature ID hsa-miR-143-3p miRNA Info
miRNA Mature AC
MIMAT0000435
Sequence ugagaugaagcacuguagcuc
miRNA Species Homo sapiens
Regulation Mechanism miR-143-3p inhibits hypertrophic scarring by regulating the proliferation and apoptosis of human HSFs, inhibiting ECM production-associated protein expression by targeting CTGF. [8]
Evidence Score (E-score) 2 +
1 Luciferase Reporter Assay [8]
2 Luciferase Reporter Assay; qRT-PCR; Western Blot [9]
Representative Target(s) Regulated by This miRNA Apoptosis regulator Bcl-2 (BCL-2) Target Info
BCL2_HUMAN
Connective tissue growth factor (CTGF) Target Info
CTGF_HUMAN
miRNA Mature ID hsa-miR-145-5p miRNA Info
miRNA Mature AC
MIMAT0000437
Sequence guccaguuuucccaggaaucccu
miRNA Species Homo sapiens
Regulation Mechanism miR-145 regulates glioma cell migration by targeting CTGF which downregulates SPARC expression. [10]
Evidence Score (E-score) 1 +
1 Luciferase Reporter Assay [10]
Representative Target(s) Regulated by This miRNA A proliferation-inducing ligand (APRIL) Target Info
TNF13_HUMAN
Alkaline phosphatase (ALPPL2) Target Info
PPBN_HUMAN
miRNA Mature ID hsa-miR-18b-5p miRNA Info
miRNA Mature AC
MIMAT0001412
Sequence uaaggugcaucuagugcaguuag
miRNA Species Homo sapiens
Regulation Mechanism miR-18b directly suppressed the expression of CTGF in NPC. [11]
Evidence Score (E-score) 1 +
1 Luciferase Reporter Assay; Western Blot [11]
Representative Target(s) Regulated by This miRNA Connective tissue growth factor (CTGF) Target Info
CTGF_HUMAN
Estrogen receptor (ESR) Target Info
ESR1_HUMAN
miRNA Mature ID hsa-miR-205-5p miRNA Info
miRNA Mature AC
MIMAT0000266
Sequence uccuucauuccaccggagucug
miRNA Species Homo sapiens
Regulation Mechanism miR-205 binds site predictions of CTGF by RNAhybrid. [12]
Evidence Score (E-score) 1 +
1 Western Blot [12]
Representative Target(s) Regulated by This miRNA Androgen receptor (AR) Target Info
ANDR_HUMAN
Apoptosis regulator Bcl-2 (BCL-2) Target Info
BCL2_HUMAN
miRNA Mature ID hsa-miR-26b-5p miRNA Info
miRNA Mature AC
MIMAT0000083
Sequence uucaaguaauucaggauaggu
miRNA Species Homo sapiens
Regulation Mechanism miR-26b mimic, but not miR-26b-mut, can specifically interact with the 3'UTRs of CTGF. [13]
Evidence Score (E-score) 1 +
1 Luciferase Reporter Assay; Western Blot [13]
Representative Target(s) Regulated by This miRNA ATP-binding cassette transporter A1 (ABCA1) Target Info
ABCA1_HUMAN
Collagen I (COL1A2) Target Info
CO1A2_HUMAN
miRNA Mature ID hsa-miR-483-3p miRNA Info
miRNA Mature AC
MIMAT0002173
Sequence ucacuccucuccucccgucuu
miRNA Species Homo sapiens
Regulation Mechanism miR-483 regulates CTCF by targeting its 3'UTR. [14]
Evidence Score (E-score) 1 +
1 Luciferase Reporter Assay [14]
Representative Target(s) Regulated by This miRNA Bcl-2-binding component 3 (BBC3) Target Info
BBC3_HUMAN
Connective tissue growth factor (CTGF) Target Info
CTGF_HUMAN
References  Top
REF 1 miR-133b Regulation of Connective Tissue Growth Factor: A Novel Mechanism in Liver Pathology. Am J Pathol. 2016 May;186(5):1092-102.
REF 2 MiR-133 modulates TGF-1-induced bladder smooth muscle cell hypertrophic and fibrotic response: implication for a role of microRNA in bladder wall remodeling caused by bladder outlet obstruction. Cell Signal. 2015 Feb;27(2):215-27.
REF 3 MicroRNA signature in wound healing following excimer laser ablation: role of miR-133b on TGF1, CTGF, SMA, and COL1A1 expression levels in rabbit corneal fibroblasts. Invest Ophthalmol Vis Sci. 2013 Oct 23;54(10):6944-51.
REF 4 TP53 regulates miRNA association with AGO2 to remodel the miRNA-mRNA interaction network. Genome Res. 2016 Mar;26(3):331-41.
REF 5 Regulation of chondrocytic phenotype by micro RNA 18a: involvement of Ccn2/Ctgf as a major target gene. FEBS Lett. 2009 Mar 18;583(6):1006-10.
REF 6 HBX Protein-Induced Downregulation of microRNA-18a is Responsible for Upregulation of Connective Tissue Growth Factor in HBV Infection-Associated Hepatocarcinoma. Med Sci Monit. 2016 Jul 16;22:2492-500.
REF 7 Comprehensive analysis of microRNA expression patterns in hepatocellular carcinoma and non-tumorous tissues. Oncogene. 2006 Apr 20;25(17):2537-45.
REF 8 MicroRNA-143-3p inhibits hyperplastic scar formation by targeting connective tissue growth factor CTGF/CCN2 via the Akt/mTOR pathway. Mol Cell Biochem. 2016 May;416(1-2):99-108.
REF 9 MiR-143 targets CTGF and exerts tumor-suppressing functions in epithelial ovarian cancer. Am J Transl Res. 2016 Jun 15;8(6):2716-26.
REF 10 MicroRNA-145 is downregulated in glial tumors and regulates glioma cell migration by targeting connective tissue growth factor. PLoS One. 2013;8(2):e54652.
REF 11 Loss of connective tissue growth factor as an unfavorable prognosis factor activates miR-18b by PI3K/AKT/C-Jun and C-Myc and promotes cell growth in nasopharyngeal carcinoma. Cell Death Dis. 2013 May 16;4:e634.
REF 12 miR-205 expression promotes cell proliferation and migration of human cervical cancer cells. PLoS One. 2012;7(10):e46990.
REF 13 CircRNA_000203 enhances the expression of fibrosis-associated genes by derepressing targets of miR-26b-5p, Col1a2 and CTGF, in cardiac fibroblasts. Sci Rep. 2017 Jan 12;7:40342.
REF 14 miR-483 Targeting of CTGF Suppresses Endothelial-to-Mesenchymal Transition: Therapeutic Implications in Kawasaki Disease. Circ Res. 2017 Jan 20;120(2):354-365.

If You Find Any Error in Data or Bug in Web Service, Please Kindly Report It to Dr. Zhou and Dr. Zhang.