Target Regulator(s) Information (MicroRNA)

Content Navigation (  All   None )                                      
Target General Information
The microRNAs (miRNAs) Regulating This Target
References
Target General Information  Top
Target ID T51734 Target Info
Target Name CCAAT/enhancer binding protein beta (CEBPB)
Synonyms Transcription factor CCAAT/enhancer-binding protein beta; Transcription factor 5; TCF5; TCF-5; PP9092; Nuclear factor NF-IL6; Liver-enriched inhibitory protein; Liver activator protein; LIP; LAP; CCAAT/enhancer-binding protein beta; C/EBP beta
Target Type Literature-reported Target
Gene Name CEBPB
Biochemical Class Basic leucine zipper bZIP
UniProt ID
P17676
The microRNAs (miRNAs) Regulating This Target  Top
miRNA Mature ID hsa-miR-155-5p miRNA Info
miRNA Mature AC
MIMAT0000646
Sequence uuaaugcuaaucgugauaggggu
miRNA Species Homo sapiens
Regulation Mechanism The overexpression of miR-155-5p by mature miRNA mimics tranfection resulted in the decreased protein level of target CEBPB. [4]
Evidence Score (E-score) 8 +
1 ChIP; ELISA; Luciferase Reporter Assay; qRT-PCR; Western Blot [1]
2 ELISA; Immunoblot; Luciferase Reporter Assay; qRT-PCR [2]
3 Luciferase Reporter Assay [3]
4 Luciferase Reporter Assay [4]
5 Luciferase Reporter Assay; qRT-PCR [5]
6 Luciferase Reporter Assay; qRT-PCR; Western Blot [6]
7 Microarray; qRT-PCR; Western Blot [7]
8 Western Blot [8]
Representative Target(s) Regulated by This miRNA Acetyl-CoA transporter (SLC33A1) Target Info
ACATN_HUMAN
Angiotensin II receptor type-1 (AGTR1) Target Info
AGTR1_HUMAN
miRNA Mature ID hsa-miR-191-5p miRNA Info
miRNA Mature AC
MIMAT0000440
Sequence caacggaaucccaaaagcagcug
miRNA Species Homo sapiens
Regulation Mechanism miR-191 was identified as an inhibitor of adipocyte differentiation through targeting the 3'UTRs (UTRs) of C/EBPb. [10]
Evidence Score (E-score) 2 +
1 Luciferase Reporter Assay; qRT-PCR; Western Blot [9]
2 Luciferase Reporter Assay; Western Blot [10]
Representative Target(s) Regulated by This miRNA CCAAT/enhancer binding protein beta (CEBPB) Target Info
CEBPB_HUMAN
Cyclin-dependent kinase 6 (CDK6) Target Info
CDK6_HUMAN
miRNA Mature ID hsa-let-7c-5p miRNA Info
miRNA Mature AC
MIMAT0000064
Sequence ugagguaguagguuguaugguu
miRNA Species Homo sapiens
Regulation Mechanism Let-7c directly targets C/EBPB by binding to its 3'UTR. [11]
Evidence Score (E-score) 1 +
1 Luciferase Reporter Assay [11]
Representative Target(s) Regulated by This miRNA Apoptosis regulator Bcl-xL (BCL-xL) Target Info
B2CL1_HUMAN
Caspase-3 (CASP3) Target Info
CASP3_HUMAN
miRNA Mature ID hsa-miR-21-5p miRNA Info
miRNA Mature AC
MIMAT0000076
Sequence uagcuuaucagacugauguuga
miRNA Species Homo sapiens
Regulation Mechanism miR-21-3p regulates CEBPB by binding its 3 'UTR. [12]
Evidence Score (E-score) 1 +
1 Luciferase Reporter Assay; Western Blot [12]
Representative Target(s) Regulated by This miRNA Apoptosis antigen ligand (CD178) Target Info
TNFL6_HUMAN
Apoptosis regulator Bcl-2 (BCL-2) Target Info
BCL2_HUMAN
miRNA Mature ID hsa-miR-34a-5p miRNA Info
miRNA Mature AC
MIMAT0000255
Sequence uggcagugucuuagcugguugu
miRNA Species Homo sapiens
Evidence Score (E-score) 1 +
1 Luciferase Reporter Assay [13]
Representative Target(s) Regulated by This miRNA Amphiregulin (AREG) Target Info
AREG_HUMAN
Androgen receptor (AR) Target Info
ANDR_HUMAN
miRNA Mature ID hsa-miR-374a-5p miRNA Info
miRNA Mature AC
MIMAT0000727
Sequence uuauaauacaaccugauaagug
miRNA Species Homo sapiens
Evidence Score (E-score) 1 +
1 Luciferase Reporter Assay [14]
Representative Target(s) Regulated by This miRNA ATM serine/threonine kinase (ATM) Target Info
ATM_HUMAN
CCAAT/enhancer binding protein beta (CEBPB) Target Info
CEBPB_HUMAN
miRNA Mature ID hsa-miR-663a miRNA Info
miRNA Mature AC
MIMAT0003326
Sequence aggcggggcgccgcgggaccgc
miRNA Species Homo sapiens
Evidence Score (E-score) 1 +
1 Microarray [15]
Representative Target(s) Regulated by This miRNA C-X-C chemokine receptor type 4 (CXCR4) Target Info
CXCR4_HUMAN
CCAAT/enhancer binding protein beta (CEBPB) Target Info
CEBPB_HUMAN
References  Top
REF 1 miR-155 regulates differentiation of brown and beige adipocytes via a bistable circuit. Nat Commun. 2013;4:1769.
REF 2 MicroRNA-155 regulates inflammatory cytokine production in tumor-associated macrophages via targeting C/EBPbeta. Cell Mol Immunol. 2009 Oct;6(5):343-52.
REF 3 Silencing of microRNA-155 in mice during acute inflammatory response leads to derepression of c/ebp Beta and down-regulation of G-CSF. Nucleic Acids Res. 2009 Sep;37(17):5784-92.
REF 4 MicroRNA-155 is an Epstein-Barr virus-induced gene that modulates Epstein-Barr virus-regulated gene expression pathways. J Virol. 2008 Jun;82(11):5295-306.
REF 5 A Kaposi's sarcoma-associated herpesvirus-encoded ortholog of microRNA miR-155 induces human splenic B-cell expansion in NOD/LtSz-scid IL2Rnull mice. J Virol. 2011 Oct;85(19):9877-86.
REF 6 MicroRNA miR-155 inhibits bone morphogenetic protein (BMP) signaling and BMP-mediated Epstein-Barr virus reactivation. J Virol. 2010 Jul;84(13):6318-27.
REF 7 MicroRNA-155 modulates the interleukin-1 signaling pathway in activated human monocyte-derived dendritic cells. Proc Natl Acad Sci U S A. 2009 Feb 24;106(8):2735-40.
REF 8 Knockdown of PU.1 AS lncRNA inhibits adipogenesis through enhancing PU.1 mRNA translation. J Cell Biochem. 2013 Nov;114(11):2500-12.
REF 9 miR-191 promotes tumorigenesis of human colorectal cancer through targeting C/EBP. Oncotarget. 2015 Feb 28;6(6):4144-58.
REF 10 PU.1 promotes miR-191 to inhibit adipogenesis in 3T3-L1 preadipocytes. Biochem Biophys Res Commun. 2014 Aug 22;451(2):329-33.
REF 11 MicroRNA let-7c regulates macrophage polarization. J Immunol. 2013 Jun 15;190(12):6542-9.
REF 12 Regulation of NF-B signaling by oxidized glycerophospholipid and IL-1 induced miRs-21-3p and -27a-5p in human aortic endothelial cells. J Lipid Res. 2015 Jan;56(1):38-50.
REF 13 MicroRNA-34a perturbs B lymphocyte development by repressing the forkhead box transcription factor Foxp1. Immunity. 2010 Jul 23;33(1):48-59.
REF 14 miRNA-374 regulates dexamethasone-induced differentiation of primary cultures of porcine adipocytes. Horm Metab Res. 2013 Jul;45(7):518-25.
REF 15 MicroRNA-663 upregulated by oscillatory shear stress plays a role in inflammatory response of endothelial cells. Am J Physiol Heart Circ Physiol. 2011 May;300(5):H1762-9.

If You Find Any Error in Data or Bug in Web Service, Please Kindly Report It to Dr. Zhou and Dr. Zhang.