Target Regulator(s) Information (MicroRNA)

Content Navigation (  All   None )                                      
Target General Information
The microRNAs (miRNAs) Regulating This Target
References
Target General Information  Top
Target ID T35445 Target Info
Target Name Mothers against decapentaplegic homolog 3 (SMAD3)
Synonyms TGF-beta response effector Smad3; Smad3; SMAD family member 3; SMAD 3; Mothers against DPP homolog 3; Mad3; MMad3; MADH3; MAD homolog 3; JV15-2; HSMAD3; HMAD-3
Target Type Preclinical Target
Gene Name SMAD3
UniProt ID
P84022
The microRNAs (miRNAs) Regulating This Target  Top
miRNA Mature ID hsa-miR-142-5p miRNA Info
miRNA Mature AC
MIMAT0000433
Sequence cauaaaguagaaagcacuacu
miRNA Species Homo sapiens
Regulation Mechanism SMAD3 was a direct target of miR-142-5p. [2]
Evidence Score (E-score) 2 +
1 Luciferase Reporter Assay; qRT-PCR; Western Blot [1]
2 Luciferase Reporter Assay; Western Blot [2]
Representative Target(s) Regulated by This miRNA Beclin-1 (BECN1) Target Info
BECN1_HUMAN
Hypoxia-inducible factor 1 alpha (HIF-1A) Target Info
HIF1A_HUMAN
miRNA Mature ID hsa-miR-145-5p miRNA Info
miRNA Mature AC
MIMAT0000437
Sequence guccaguuuucccaggaaucccu
miRNA Species Homo sapiens
Evidence Score (E-score) 2 +
1 Luciferase Reporter Assay [3]
2 Luciferase Reporter Assay; Western Blot; qRT-PCR; ELISA; Immunofluorescence [4]
Representative Target(s) Regulated by This miRNA A proliferation-inducing ligand (APRIL) Target Info
TNF13_HUMAN
Alkaline phosphatase (ALPPL2) Target Info
PPBN_HUMAN
miRNA Mature ID hsa-miR-23a-3p miRNA Info
miRNA Mature AC
MIMAT0000078
Sequence aucacauugccagggauuucc
miRNA Species Homo sapiens
Regulation Mechanism Overexpression of miR-23a-3p inhibited the mRNA and protein expression of SMAD3 while the miR-23a-3p inhibitor increased SMAD3 mRNA and protein levels. [6]
Evidence Score (E-score) 2 +
1 Luciferase Reporter Assay; Western Blot [5]
2 Luciferase Reporter Assay; Western Blot [6]
Representative Target(s) Regulated by This miRNA Apoptosis mediating surface antigen FAS (FAS) Target Info
TNR6_HUMAN
DNA topoisomerase I (TOP1) Target Info
TOP1_HUMAN
miRNA Mature ID hsa-miR-708-5p miRNA Info
miRNA Mature AC
MIMAT0004926
Sequence aaggagcuuacaaucuagcuggg
miRNA Species Homo sapiens
Regulation Mechanism SMAD3 is a direct target of miR-708. [8]
Evidence Score (E-score) 2 +
1 Dual Luciferase Reporter Assay; Western Blot [7]
2 Luciferase Reporter Assay [8]
Representative Target(s) Regulated by This miRNA Apoptosis inhibitor survivin (BIRC5) Target Info
BIRC5_HUMAN
Apoptosis regulator Bcl-2 (BCL-2) Target Info
BCL2_HUMAN
miRNA Mature ID hsa-miR-92b-3p miRNA Info
miRNA Mature AC
MIMAT0003218
Sequence uauugcacucgucccggccucc
miRNA Species Homo sapiens
Regulation Mechanism miR-92b directly affected SMAD3 expression by targeting the 3'UTR. [9]
Evidence Score (E-score) 2 +
1 Luciferase Reporter Assay; Western Blot [9]
2 Luciferase Reporter Assay; Western Blot [10]
Representative Target(s) Regulated by This miRNA CDK inhibitor 1C p57Kip2 (CDKN1C) Target Info
CDN1C_HUMAN
Dickkopf-related protein 3 (DKK3) Target Info
DKK3_HUMAN
miRNA Mature ID hsa-miR-155-5p miRNA Info
miRNA Mature AC
MIMAT0000646
Sequence uuaaugcuaaucgugauagggguu
miRNA Species Homo sapiens
Evidence Score (E-score) 1 +
1 Western Blot [11]
Representative Target(s) Regulated by This miRNA Acetyl-CoA transporter (SLC33A1) Target Info
ACATN_HUMAN
Angiotensin II receptor type-1 (AGTR1) Target Info
AGTR1_HUMAN
miRNA Mature ID hsa-miR-18a-5p miRNA Info
miRNA Mature AC
MIMAT0000072
Sequence uaaggugcaucuagugcagauag
miRNA Species Homo sapiens
Regulation Mechanism miR-18a directly targets human Smad3. [12]
Evidence Score (E-score) 1 +
1 Western Blot [12]
Representative Target(s) Regulated by This miRNA Apoptosis mediating surface antigen FAS (FAS) Target Info
TNR6_HUMAN
Apoptosis regulator Bcl-2 (BCL-2) Target Info
BCL2_HUMAN
miRNA Mature ID hsa-miR-193b-3p miRNA Info
miRNA Mature AC
MIMAT0002819
Sequence aacuggcccucaaagucccgcu
miRNA Species Homo sapiens
Regulation Mechanism Downregulation of miR-193b by inhibitors was statistically correlated with a decrease in cell growth and a restored G1 accumulation. Luciferase assay and Western blot analysis revealed that Smad3 is a direct target of miR-193b. [13]
Evidence Score (E-score) 1 +
1 Luciferase Reporter Assay; Western Blot [13]
Representative Target(s) Regulated by This miRNA DNA repair protein RAD51 homolog 1 (RAD51) Target Info
RAD51_HUMAN
Estrogen receptor (ESR) Target Info
ESR1_HUMAN
miRNA Mature ID hsa-miR-200a-3p miRNA Info
miRNA Mature AC
MIMAT0000682
Sequence uaacacugucugguaacgaugu
miRNA Species Homo sapiens
Regulation Mechanism Smad3 regulates E-cadherin via miRNA-200 pathway. [14]
Evidence Score (E-score) 1 +
1 Luciferase Reporter Assay [14]
Representative Target(s) Regulated by This miRNA Amphiregulin (AREG) Target Info
AREG_HUMAN
Beta-catenin (CTNNB1) Target Info
CTNB1_HUMAN
miRNA Mature ID hsa-miR-29b-1-5p miRNA Info
miRNA Mature AC
MIMAT0004514
Sequence gcugguuucauauggugguuuaga
miRNA Species Homo sapiens
Regulation Mechanism Infection with miR-29b mimics suppressed Smad3 expression, suggesting that miR-29b inhibited LX-2 activation mediated by Smad3. [15]
Evidence Score (E-score) 1 +
1 qRT-PCR; Western Blot [15]
Representative Target(s) Regulated by This miRNA Janus kinase 3 (JAK-3) Target Info
JAK3_HUMAN
Mothers against decapentaplegic homolog 3 (SMAD3) Target Info
SMAD3_HUMAN
miRNA Mature ID hsa-miR-424-5p miRNA Info
miRNA Mature AC
MIMAT0001341
Sequence cagcagcaauucauguuuugaa
miRNA Species Homo sapiens
Regulation Mechanism miR-424-5p could inhibit TGFB signaling pathway by SMAD3. [16]
Evidence Score (E-score) 1 +
1 Immunohistochemistry; Luciferase Reporter Assay; Western Blot [16]
Representative Target(s) Regulated by This miRNA Checkpoint kinase-1 (CHK1) Target Info
CHK1_HUMAN
Cyclin D (CCND3) Target Info
CCND3_HUMAN
miRNA Mature ID hsa-miR-491-5p miRNA Info
miRNA Mature AC
MIMAT0002807
Sequence aguggggaacccuuccaugagg
miRNA Species Homo sapiens
Regulation Mechanism miR-491 which targeted the SMAD3-3'UTR, decreased the expression/function of SMAD3, leading to the inactivation of NF-kB/IL-6/STAT-3 signaling. [17]
Evidence Score (E-score) 1 +
1 Luciferase Reporter Assay; Western Blot [17]
Representative Target(s) Regulated by This miRNA Apoptosis regulator Bcl-xL (BCL-xL) Target Info
B2CL1_HUMAN
Cellular tumor antigen p53 (TP53) Target Info
P53_HUMAN
miRNA Mature ID hsa-miR-497-5p miRNA Info
miRNA Mature AC
MIMAT0002820
Sequence cagcagcacacugugguuugu
miRNA Species Homo sapiens
Regulation Mechanism miR-497-5p negatively regulated SMAD3. [18]
Evidence Score (E-score) 1 +
1 qRT-PCR [18]
Representative Target(s) Regulated by This miRNA Angiomotin (AMOT) Target Info
AMOT_HUMAN
Apoptosis inhibitor survivin (BIRC5) Target Info
BIRC5_HUMAN
miRNA Mature ID hsa-miR-590-5p miRNA Info
miRNA Mature AC
MIMAT0003258
Sequence gagcuuauucauaaaagugcag
miRNA Species Homo sapiens
Evidence Score (E-score) 1 +
1 Luciferase Reporter Assay [19]
Representative Target(s) Regulated by This miRNA Cyclic-AMP-dependent transcription factor ATF-3 (ATF3) Target Info
ATF3_HUMAN
Lectin-like oxidized LDL receptor (OLR1) Target Info
OLR1_HUMAN
miRNA Mature ID hsa-miR-145-3p miRNA Info
miRNA Mature AC
MIMAT0004601
Sequence ggauuccuggaaauacuguucu
miRNA Species Homo sapiens
Regulation Mechanism miR-145 targets SMAD3. [20]
Evidence Score (E-score) 1 +
1 ELISA; Luciferase Reporter Assay [20]
Representative Target(s) Regulated by This miRNA Matrix metalloproteinase-16 (MMP-16) Target Info
MMP16_HUMAN
Metastasis adhesion protein (MTDH) Target Info
LYRIC_HUMAN
miRNA Mature ID hsa-miR-23b-5p miRNA Info
miRNA Mature AC
MIMAT0004587
Sequence uggguuccuggcaugcugauuu
miRNA Species Homo sapiens
Regulation Mechanism miR-23b binds directly to the 3'UTR of SMAD3 to repress its expression. [21]
Evidence Score (E-score) 1 +
1 Immunohistochemistry; Luciferase Reporter Assay; Western Blot [21]
Representative Target(s) Regulated by This miRNA Mothers against decapentaplegic homolog 3 (SMAD3) Target Info
SMAD3_HUMAN
TGF-beta receptor type II (TGFBR2) Target Info
TGFR2_HUMAN
miRNA Mature ID hsa-miR-323a-3p miRNA Info
miRNA Mature AC
MIMAT0000755
Sequence cacauuacacggucgaccucu
miRNA Species Homo sapiens
Regulation Mechanism miR-323-3p directly associated with the mRNA 3'UTR regions of SMAD3 transcript identifying SMAD3 as bona fide target of miR-323-3p. [22]
Evidence Score (E-score) 1 +
1 Immunoprecipitation; Luciferase Reporter Assay; Western Blot [22]
Representative Target(s) Regulated by This miRNA CDK inhibitor 1B p27Kip1 (CDKN1B) Target Info
CDN1B_HUMAN
Mothers against decapentaplegic homolog 3 (SMAD3) Target Info
SMAD3_HUMAN
References  Top
REF 1 MicroRNA regulatory pathway analysis identifies miR-142-5p as a negative regulator of TGF- pathway via targeting SMAD3. Oncotarget. 2016 Nov 1;7(44):71504-71513.
REF 2 Rotavirus-induced miR-142-5p elicits proviral milieu by targeting non-canonical transforming growth factor beta signalling and apoptosis in cells. Cell Microbiol. 2016 May;18(5):733-47.
REF 3 Elevated levels of miR-145 correlate with SMAD3 down-regulation in cystic fibrosis patients. J Cyst Fibros. 2013 Dec;12(6):797-802.
REF 4 Effect of microRNA-145 on IL-1-induced cartilage degradation in human chondrocytes. FEBS Lett. 2014 Jun 27;588(14):2344-52.
REF 5 MicroRNA-23a regulates epithelial-to-mesenchymal transition in endometrial endometrioid adenocarcinoma by targeting SMAD3. Cancer Cell Int. 2016 Sep 5;16(1):67.
REF 6 MicroRNA-23a-3p promotes the development of osteoarthritis by directly targeting SMAD3 in chondrocytes. Biochem Biophys Res Commun. 2016 Sep 9;478(1):467-473.
REF 7 miRNA-708 functions as a tumour suppressor in hepatocellular carcinoma by targeting SMAD3. Oncol Lett. 2017 Aug;14(2):2552-2558.
REF 8 MiR-708 promotes steroid-induced osteonecrosis of femoral head, suppresses osteogenic differentiation by targeting SMAD3. Sci Rep. 2016 Mar 2;6:22599.
REF 9 The miR-92b functions as a potential oncogene by targeting on Smad3 in glioblastomas. Brain Res. 2013 Sep 5;1529:16-25.
REF 10 MicroRNA-92b inhibits epithelial-mesenchymal transition-induced migration and invasion by targeting Smad3 in nasopharyngeal cancer. Oncotarget. 2017 Sep 27;8(53):91603-91613.
REF 11 MicroRNA-155 targets SMAD2 and modulates the response of macrophages to transforming growth factor-{beta}. J Biol Chem. 2010 Dec 31;285(53):41328-36.
REF 12 Targeting of TGF signature and its essential component CTGF by miR-18 correlates with improved survival in glioblastoma. RNA. 2013 Feb;19(2):177-90.
REF 13 miR-193b promotes cell proliferation by targeting Smad3 in human glioma. J Neurosci Res. 2014 May;92(5):619-26.
REF 14 Smad3 regulates E-cadherin via miRNA-200 pathway. Oncogene. 2012 Jun 21;31(25):3051-9.
REF 15 Suppressive effect of microRNA-29b on hepatic stellate cell activation and its crosstalk with TGF-1/Smad3. Cell Biochem Funct. 2016 Jul;34(5):326-33.
REF 16 miR-424-5p promotes proliferation of gastric cancer by targeting Smad3 through TGF- signaling pathway. Oncotarget. 2016 Nov 15;7(46):75185-75196.
REF 17 Inhibition of TGF-/SMAD3/NF-B signaling by microRNA-491 is involved in arsenic trioxide-induced anti-angiogenesis in hepatocellular carcinoma cells. Toxicol Lett. 2014 Nov 18;231(1):55-61.
REF 18 Experimental evidences for hsa-miR-497-5p as a negative regulator of SMAD3 gene expression. Gene. 2016 Jul 25;586(2):216-21.
REF 19 Hsa-miR-590-5p Interaction with SMAD3 Transcript Supports Its Regulatory Effect on The TGF Signaling Pathway. Cell J. 2016 Spring;18(1):7-12.
REF 20 Peroxisome proliferator-activated receptor- (PPAR-) agonist inhibits collagen synthesis in human hypertrophic scar fibroblasts by targeting Smad3 via miR-145. Biochem Biophys Res Commun. 2015 Mar 27;459(1):49-53.
REF 21 MicroRNA-23b Inhibits the Proliferation and Migration of Heat-Denatured Fibroblasts by Targeting Smad3. PLoS One. 2015 Jul 8;10(7):e0131867.
REF 22 MicroRNA-323-3p inhibits cell invasion and metastasis in pancreatic ductal adenocarcinoma via direct suppression of SMAD2 and SMAD3. Oncotarget. 2016 Mar 22;7(12):14912-24.

If You Find Any Error in Data or Bug in Web Service, Please Kindly Report It to Dr. Zhou and Dr. Zhang.