Target Regulator(s) Information (MicroRNA)

Content Navigation (  All   None )                                      
Target General Information
The microRNAs (miRNAs) Regulating This Target
References
Target General Information  Top
Target ID T56556 Target Info
Target Name ATP-binding cassette transporter G2 (ABCG2)
Synonyms Urate exporter; Placenta-specific ATP-binding cassette transporter; Mitoxantrone resistance-associated protein; MXR; CDw338; CD338; Breast cancer resistance protein; BCRP1; BCRP; ABCP
Target Type Successful Target
Gene Name ABCG2
Biochemical Class ABC transporter
UniProt ID
Q9UNQ0
The microRNAs (miRNAs) Regulating This Target  Top
miRNA Mature ID hsa-miR-328-3p miRNA Info
miRNA Mature AC
MIMAT0000752
Sequence cuggcccucucugcccuuccgu
miRNA Species Homo sapiens
Regulation Mechanism The overexpression of miR-328-3p resulted in the decreased protein level of target ABCG2. [2]
Evidence Score (E-score) 4 +
1 Immunoblot; Luciferase Reporter Assay; qRT-PCR [1]
2 Immunoblot; Luciferase Reporter Assay; qRT-PCR [2]
3 Luciferase Reporter Assay; qRT-PCR; Western Blot [3]
4 Luciferase Reporter Assay; qRT-PCR; Western Blot [4]
Representative Target(s) Regulated by This miRNA ATP-binding cassette transporter G2 (ABCG2) Target Info
ABCG2_HUMAN
Beta-secretase 1 (BACE1) Target Info
BACE1_HUMAN
miRNA Mature ID hsa-miR-519c-3p miRNA Info
miRNA Mature AC
MIMAT0002832
Sequence aaagugcaucuuuuuagaggau
miRNA Species Homo sapiens
Evidence Score (E-score) 4 +
1 Immunoblot; Luciferase Reporter Assay; qRT-PCR [1]
2 Luciferase Reporter Assay [5]
3 Luciferase Reporter Assay; Western Blot; qRT-PCR [2]
4 Western Blot; Luciferase Reporter Assay; qRT-PCR [6]
Representative Target(s) Regulated by This miRNA ATP-binding cassette transporter G2 (ABCG2) Target Info
ABCG2_HUMAN
ELAV-like protein 1 (ELAVL1) Target Info
ELAV1_HUMAN
miRNA Mature ID hsa-miR-520h miRNA Info
miRNA Mature AC
MIMAT0002867
Sequence acaaagugcuucccuuuagagu
miRNA Species Homo sapiens
Evidence Score (E-score) 3 +
1 Luciferase Reporter Assay [5]
2 Luciferase Reporter Assay; Microarray [2]
3 qRT-PCR; Western Blot [7]
Representative Target(s) Regulated by This miRNA ATP-binding cassette transporter G2 (ABCG2) Target Info
ABCG2_HUMAN
Histone deacetylase 1 (HDAC1) Target Info
HDAC1_HUMAN
miRNA Mature ID hsa-miR-142-3p miRNA Info
miRNA Mature AC
MIMAT0000434
Sequence uguaguguuuccuacuuuaugga
miRNA Species Homo sapiens
Regulation Mechanism The miR-142-3p mimics significantly reduced the luciferase activity of the ABCG2 reporters compared to NSC. [8]
Evidence Score (E-score) 1 +
1 Luciferase Reporter Assay; Western Blot [8]
Representative Target(s) Regulated by This miRNA ATP-binding cassette transporter G2 (ABCG2) Target Info
ABCG2_HUMAN
High mobility group protein B1 (HMGB1) Target Info
HMGB1_HUMAN
miRNA Mature ID hsa-miR-212-3p miRNA Info
miRNA Mature AC
MIMAT0000269
Sequence uaacagucuccagucacggcc
miRNA Species Homo sapiens
Evidence Score (E-score) 1 +
1 Luciferase Reporter Assay [9]
Representative Target(s) Regulated by This miRNA Acetylcholinesterase (AChE) Target Info
ACES_HUMAN
Adenylate cyclase type 1 (ADCY1) Target Info
ADCY1_HUMAN
miRNA Mature ID hsa-miR-222-3p miRNA Info
miRNA Mature AC
MIMAT0000279
Sequence agcuacaucuggcuacugggu
miRNA Species Homo sapiens
Regulation Mechanism Luciferase assays revealed that ABCG2 is a direct target of miR-222. [10]
Evidence Score (E-score) 1 +
1 Luciferase Reporter Assay; Western Blot [10]
Representative Target(s) Regulated by This miRNA AN1-type zinc finger protein 5 (ZFAND5) Target Info
ZFAN5_HUMAN
ATP-binding cassette transporter G2 (ABCG2) Target Info
ABCG2_HUMAN
miRNA Mature ID hsa-miR-4496 miRNA Info
miRNA Mature AC
MIMAT0019031
Sequence gaggaaacugaagcugagaggg
miRNA Species Homo sapiens
Regulation Mechanism miR-4496 decreased CagA-induced chemoresistance by targeting ATP-binding cassette, subfamily G, member 2 (ABCG2) at the transcriptional and post-transcriptional levels respectively. [11]
Evidence Score (E-score) 1 +
1 Luciferase Reporter Assay; Western Blot [11]
Representative Target(s) Regulated by This miRNA ATP-binding cassette transporter G2 (ABCG2) Target Info
ABCG2_HUMAN
miRNA Mature ID hsa-miR-487a-3p miRNA Info
miRNA Mature AC
MIMAT0002178
Sequence aaucauacagggacauccaguu
miRNA Species Homo sapiens
Evidence Score (E-score) 1 +
1 Luciferase Reporter Assay; Western Blot [12]
Representative Target(s) Regulated by This miRNA ATP-binding cassette transporter G2 (ABCG2) Target Info
ABCG2_HUMAN
References  Top
REF 1 Breast cancer resistance protein BCRP/ABCG2 regulatory microRNAs (hsa-miR-328, -519c and -520h) and their differential expression in stem-like ABCG2+ cancer cells. Biochem Pharmacol. 2011 Mar 15;81(6):783-92.
REF 2 MicroRNAs play a role in the development of human hematopoietic stem cells. J Cell Biochem. 2008 Jun 1;104(3):805-17.
REF 3 MicroRNA expression profiling identifies miR-328 regulates cancer stem cell-like SP cells in colorectal cancer. Br J Cancer. 2012 Mar 27;106(7):1320-30.
REF 4 MicroRNA-328 negatively regulates the expression of breast cancer resistance protein (BCRP/ABCG2) in human cancer cells. Mol Pharmacol. 2009 Jun;75(6):1374-9.
REF 5 Escape from hsa-miR-519c enables drug-resistant cells to maintain high expression of ABCG2. Mol Cancer Ther. 2009 Oct;8(10):2959-68.
REF 6 Regulation of ABCG2 expression at the 3' untranslated region of its mRNA through modulation of transcript stability and protein translation by a putative microRNA in the S1 colon cancer cell line. Mol Cell Biol. 2008 Sep;28(17):5147-61.
REF 7 hsa-miR-520h downregulates ABCG2 in pancreatic cancer cells to inhibit migration, invasion, and side populations. Br J Cancer. 2010 Aug 10;103(4):567-74.
REF 8 MiR-142-3p functions as a tumor suppressor by targeting CD133, ABCG2, and Lgr5 in colon cancer cells. J Mol Med (Berl). 2013 Aug;91(8):989-1000.
REF 9 SOX11 identified by target gene evaluation of miRNAs differentially expressed in focal and non-focal brain tissue of therapy-resistant epilepsy patients. Neurobiol Dis. 2015 May;77:127-40.
REF 10 Deregulation of the miR-222-ABCG2 regulatory module in tongue squamous cell carcinoma contributes to chemoresistance and enhanced migratory/invasive potential. Oncotarget. 2015 Dec 29;6(42):44538-50.
REF 11 MicroRNA-320a and microRNA-4496 attenuate Helicobacter pylori cytotoxin-associated gene A (CagA)-induced cancer-initiating potential and chemoresistance by targeting -catenin and ATP-binding cassette, subfamily G, member 2. J Pathol. 2017 Apr;241(5):614-625.
REF 12 MiR-487a resensitizes mitoxantrone (MX)-resistant breast cancer cells (MCF-7/MX) to MX by targeting breast cancer resistance protein (BCRP/ABCG2). Cancer Lett. 2013 Oct 1;339(1):107-15.

If You Find Any Error in Data or Bug in Web Service, Please Kindly Report It to Dr. Zhou and Dr. Zhang.