Target Regulator(s) Information (MicroRNA)

Content Navigation (  All   None )                                      
Target General Information
The microRNAs (miRNAs) Regulating This Target
References
Target General Information  Top
Target ID T57943 Target Info
Target Name Caspase-3 (CASP3)
Synonyms Yama protein; SREBP cleavage activity 1; SCA-1; Protein Yama; Cysteine protease CPP32; Caspase 3; CPP32; CPP-32; CASP-3; Apopain
Target Type Clinical trial Target
Gene Name CASP3
Biochemical Class Peptidase
UniProt ID
P42574
The microRNAs (miRNAs) Regulating This Target  Top
miRNA Mature ID hsa-let-7a-5p miRNA Info
miRNA Mature AC
MIMAT0000062
Sequence ugagguaguagguuguauaguu
miRNA Species Homo sapiens
Regulation Mechanism The overexpression of let-7a-5p by mature miRNA precursor transfection resulted in the decreased protein level of target CASP3. [1]
Evidence Score (E-score) 2 +
1 Luciferase Reporter Assay [1]
2 Western Blot; qRT-PCR; Luciferase Reporter Assay [1]
Representative Target(s) Regulated by This miRNA Caspase-3 (CASP3) Target Info
CASP3_HUMAN
GTPase HRas (HRAS) Target Info
RASH_HUMAN
miRNA Mature ID hsa-miR-155-5p miRNA Info
miRNA Mature AC
MIMAT0000646
Sequence uuaaugcuaaucgugauagggguu
miRNA Species Homo sapiens
Regulation Mechanism CASP-3 3 'UTR mediates miR-155-dependent mRNA degradation. [2]
Evidence Score (E-score) 2 +
1 Luciferase Reporter Assay [2]
2 Western Blot [3]
Representative Target(s) Regulated by This miRNA Acetyl-CoA transporter (SLC33A1) Target Info
ACATN_HUMAN
Angiotensin II receptor type-1 (AGTR1) Target Info
AGTR1_HUMAN
miRNA Mature ID hsa-miR-224-5p miRNA Info
miRNA Mature AC
MIMAT0000281
Sequence ucaagucacuagugguuccguuuag
miRNA Species Homo sapiens
Regulation Mechanism miR-224 negatively regulates CASP3 expressions by directly interacting with its 3'UTR. [4]
Evidence Score (E-score) 2 +
1 Luciferase Reporter Assay; Western Blot [4]
2 qRT-PCR [5]
Representative Target(s) Regulated by This miRNA APJ endogenous ligand (Apelin) Target Info
APEL_HUMAN
Apoptosis regulator Bcl-2 (BCL-2) Target Info
BCL2_HUMAN
miRNA Mature ID hsa-miR-98-5p miRNA Info
miRNA Mature AC
MIMAT0000096
Sequence ugagguaguaaguuguauuguu
miRNA Species Homo sapiens
Regulation Mechanism miR-98 decreased the luciferase activity by targeting the 30 untranslated region of caspase-3. [7]
Evidence Score (E-score) 2 +
1 Luciferase Reporter Assay [6]
2 Luciferase Reporter Assay; Western Blot [7]
Representative Target(s) Regulated by This miRNA Apoptosis regulator Bcl-2 (BCL-2) Target Info
BCL2_HUMAN
Aromatase (CYP19A1) Target Info
CP19A_HUMAN
miRNA Mature ID hsa-miR-421 miRNA Info
miRNA Mature AC
MIMAT0003339
Sequence aucaacagacauuaauugggcgc
miRNA Species Homo sapiens
Regulation Mechanism miR-421 acts as a tumor promoter by targeting the caspase-3 gene and preventing apoptosis of gastric cancer cells through inhibition of caspase-3 expression. [9]
Evidence Score (E-score) 2 +
1 Luciferase Reporter Assay; Immunofluorescence; Immunohistochemistry; qRT-PCR; Western Blot [8]
2 qRT-PCR; Western Blot [9]
Representative Target(s) Regulated by This miRNA ATM serine/threonine kinase (ATM) Target Info
ATM_HUMAN
Caspase-3 (CASP3) Target Info
CASP3_HUMAN
miRNA Mature ID hsa-let-7c-5p miRNA Info
miRNA Mature AC
MIMAT0000064
Sequence ugagguaguagguuguaugguu
miRNA Species Homo sapiens
Regulation Mechanism Overexpression of let-7c-5p inhibited microglial activation via the direct targeting the Caspase 3 3'UTR. [10]
Evidence Score (E-score) 1 +
1 Luciferase Reporter Assay; Western Blot [10]
Representative Target(s) Regulated by This miRNA Apoptosis regulator Bcl-xL (BCL-xL) Target Info
B2CL1_HUMAN
Caspase-3 (CASP3) Target Info
CASP3_HUMAN
miRNA Mature ID hsa-let-7g-5p miRNA Info
miRNA Mature AC
MIMAT0000414
Sequence ugagguaguaguuuguacaguu
miRNA Species Homo sapiens
Regulation Mechanism hsa-Let-7g Targets 3' UTR of CASP3 and Inhibits CASP3 Expression. [11]
Evidence Score (E-score) 1 +
1 Luciferase Reporter Assay [11]
Representative Target(s) Regulated by This miRNA Apoptosis regulator Bcl-xL (BCL-xL) Target Info
B2CL1_HUMAN
Caspase-3 (CASP3) Target Info
CASP3_HUMAN
miRNA Mature ID hsa-miR-26a-1-3p miRNA Info
miRNA Mature AC
MIMAT0004499
Sequence ccuauucuugguuacuugcacg
miRNA Species Homo sapiens
Regulation Mechanism miR-26a directly targets CASP3. [12]
Evidence Score (E-score) 1 +
1 qRT-PCR; Western Blot [12]
Representative Target(s) Regulated by This miRNA Apoptosis regulator Bcl-2 (BCL-2) Target Info
BCL2_HUMAN
Caspase-3 (CASP3) Target Info
CASP3_HUMAN
miRNA Mature ID hsa-miR-30d-5p miRNA Info
miRNA Mature AC
MIMAT0000245
Sequence uguaaacauccccgacuggaag
miRNA Species Homo sapiens
Regulation Mechanism miR-30d regulates a large number of cancer-associated genes, including the apoptotic caspase CASP3. [13]
Evidence Score (E-score) 1 +
1 Luciferase Reporter Assay; Western Blot [13]
Representative Target(s) Regulated by This miRNA Autophagy-related 2B (ATG2B) Target Info
ATG2B_HUMAN
Beclin-1 (BECN1) Target Info
BECN1_HUMAN
miRNA Mature ID hsa-miR-30e-5p miRNA Info
miRNA Mature AC
MIMAT0000692
Sequence uguaaacauccuugacuggaag
miRNA Species Homo sapiens
Regulation Mechanism Caspase-3 mRNA is a direct miR-30e target. [14]
Evidence Score (E-score) 1 +
1 Luciferase Reporter Assay [14]
Representative Target(s) Regulated by This miRNA Caspase-3 (CASP3) Target Info
CASP3_HUMAN
Cellular tumor antigen p53 (TP53) Target Info
P53_HUMAN
miRNA Mature ID hsa-miR-363-3p miRNA Info
miRNA Mature AC
MIMAT0000707
Sequence aauugcacgguauccaucugua
miRNA Species Homo sapiens
Regulation Mechanism miR-363 directly targets Caspase 3. [15]
Evidence Score (E-score) 1 +
1 Luciferase Reporter Assay; Western Blot [15]
Representative Target(s) Regulated by This miRNA Caspase-3 (CASP3) Target Info
CASP3_HUMAN
Cyclic AMP-responsive element-binding protein (CREB1) Target Info
CREB1_HUMAN
miRNA Mature ID hsa-miR-582-5p miRNA Info
miRNA Mature AC
MIMAT0003247
Sequence uuacaguuguucaaccaguuacu
miRNA Species Homo sapiens
Regulation Mechanism miR-582-5p directly targets Caspase 3. [15]
Evidence Score (E-score) 1 +
1 Luciferase Reporter Assay; Western Blot [15]
Representative Target(s) Regulated by This miRNA Caspase-3 (CASP3) Target Info
CASP3_HUMAN
Caspase-9 (CASP9) Target Info
CASP9_HUMAN
miRNA Mature ID hsa-miR-885-5p miRNA Info
miRNA Mature AC
MIMAT0004947
Sequence uccauuacacuacccugccucu
miRNA Species Homo sapiens
Regulation Mechanism miR-885-5p binding on 3'UTR of CASP3 modulates CASP3 expression at both mRNA and protein levels. [16]
Evidence Score (E-score) 1 +
1 Luciferase Reporter Assay [16]
Representative Target(s) Regulated by This miRNA Beta-catenin (CTNNB1) Target Info
CTNB1_HUMAN
Caspase-3 (CASP3) Target Info
CASP3_HUMAN
miRNA Mature ID hsa-let-7b-3p miRNA Info
miRNA Mature AC
MIMAT0004482
Sequence cuauacaaccuacugccuuccc
miRNA Species Homo sapiens
Regulation Mechanism Transfection with let-7b mimics significantly decreased the expression of caspase-3 indicating that let-7b directly targeted caspase-3. [17]
Evidence Score (E-score) 1 +
1 Immunohistochemistry; Luciferase Reporter Assay; Western Blot [17]
Representative Target(s) Regulated by This miRNA Caspase-3 (CASP3) Target Info
CASP3_HUMAN
References  Top
REF 1 Let-7a microRNA suppresses therapeutics-induced cancer cell death by targeting caspase-3. Apoptosis. 2008 Oct;13(10):1215-22.
REF 2 miR-155 targets Caspase-3 mRNA in activated macrophages. RNA Biol. 2016;13(1):43-58.
REF 3 MicroRNA-155 Downregulation Promotes Cell Cycle Arrest and Apoptosis in Diffuse Large B-Cell Lymphoma. Oncol Res. 2016 Oct 27;24(6):415-427.
REF 4 MicroRNA-224 is implicated in lung cancer pathogenesis through targeting caspase-3 and caspase-7. Oncotarget. 2015 Sep 8;6(26):21802-15.
REF 5 miR-224 Is Significantly Upregulated and Targets Caspase-3 and Caspase-7 During Colorectal Carcinogenesis. Transl Oncol. 2019 Feb;12(2):282-291.
REF 6 MicroRNA-98 negatively regulates myocardial infarction-induced apoptosis by down-regulating Fas and caspase-3. Sci Rep. 2017 Aug 7;7(1):7460.
REF 7 miR-98 protects endothelial cells against hypoxia/reoxygenation induced-apoptosis by targeting caspase-3. Biochem Biophys Res Commun. 2015 Nov 20;467(3):595-601.
REF 8 MicroRNA-421 regulated by HIF-1 promotes metastasis, inhibits apoptosis, and induces cisplatin resistance by targeting E-cadherin and caspase-3 in gastric cancer. Oncotarget. 2016 Apr 26;7(17):24466-82.
REF 9 MiR-421 regulates apoptosis of BGC-823 gastric cancer cells by targeting caspase-3. Asian Pac J Cancer Prev. 2014;15(13):5463-8.
REF 10 MicroRNA let-7c-5p protects against cerebral ischemia injury via mechanisms involving the inhibition of microglia activation. Brain Behav Immun. 2015 Oct;49:75-85.
REF 11 Hsa-let-7g miRNA targets caspase-3 and inhibits the apoptosis induced by ox-LDL in endothelial cells. Int J Mol Sci. 2013 Nov 18;14(11):22708-20.
REF 12 The Antitumor Effect of Metformin Is Mediated by miR-26a in Breast Cancer. Int J Mol Sci. 2016 Aug 10;17(8). pii: E1298.
REF 13 A combined array-based comparative genomic hybridization and functional library screening approach identifies mir-30d as an oncomir in cancer. Cancer Res. 2012 Jan 1;72(1):154-64.
REF 14 miR-30e controls DNA damage-induced stress responses by modulating expression of the CDK inhibitor p21WAF1/CIP1 and caspase-3. Oncotarget. 2016 Mar 29;7(13):15915-29.
REF 15 Novel anti-apoptotic microRNAs 582-5p and 363 promote human glioblastoma stem cell survival via direct inhibition of caspase 3, caspase 9, and Bim. PLoS One. 2014 May 7;9(5):e96239.
REF 16 A functional variant at the miR-885-5p binding site of CASP3 confers risk of both index and second primary malignancies in patients with head and neck cancer. FASEB J. 2013 Apr;27(4):1404-12.
REF 17 let-7b suppresses apoptosis and autophagy of human mesenchymal stem cells transplanted into ischemia/reperfusion injured heart 7by targeting caspase-3. Stem Cell Res Ther. 2015 Aug 22;6:147.

If You Find Any Error in Data or Bug in Web Service, Please Kindly Report It to Dr. Zhou and Dr. Zhang.