Target Regulator(s) Information (MicroRNA)

Content Navigation (  All   None )                                      
Target General Information
The microRNAs (miRNAs) Regulating This Target
References
Target General Information  Top
Target ID T70176 Target Info
Target Name Cyclin-dependent kinase 2 (CDK2)
Synonyms Sin3 associated polypeptide; SIN3-associated protein; P33 protein kinase; Cell division protein kinase 2; CDKN2
Target Type Clinical trial Target
Gene Name CDK2
Biochemical Class Kinase
UniProt ID
P24941
The microRNAs (miRNAs) Regulating This Target  Top
miRNA Mature ID hsa-miR-223-3p miRNA Info
miRNA Mature AC
MIMAT0000280
Sequence ugucaguuugucaaauacccca
miRNA Species Homo sapiens
Evidence Score (E-score) 2 +
1 Luciferase Reporter Assay; Western Blot [1]
2 Western Blot [2]
Representative Target(s) Regulated by This miRNA ATM serine/threonine kinase (ATM) Target Info
ATM_HUMAN
C-X-C motif chemokine 2 (CXCL2) Target Info
CXCL2_HUMAN
miRNA Mature ID hsa-miR-302d-3p miRNA Info
miRNA Mature AC
MIMAT0000718
Sequence uaagugcuuccauguuugagugu
miRNA Species Homo sapiens
Regulation Mechanism The overexpression of miR-302d-3p by mature miRNA mimics tranfection resulted in the decreased protein level of target CDK2. [4]
Evidence Score (E-score) 2 +
1 Luciferase Reporter Assay; Microarray; Northern Blot; Western Blot [3]
2 Luciferase Reporter Assay; Microarray; Northern Blot; Western Blot [4]
Representative Target(s) Regulated by This miRNA Cyclin-dependent kinase 2 (CDK2) Target Info
CDK2_HUMAN
Erbb4 tyrosine kinase receptor (Erbb-4) Target Info
ERBB4_HUMAN
miRNA Mature ID hsa-miR-372-3p miRNA Info
miRNA Mature AC
MIMAT0000724
Sequence aaagugcugcgacauuugagcgu
miRNA Species Homo sapiens
Regulation Mechanism Upregulation of CDK2 by CUL4B is achieved via the repression of miR-372, which targets CDK2. [6]
Evidence Score (E-score) 2 +
1 GFP Reporter Assay; qRT-PCR; Western Blot [5]
2 Luciferase Reporter Assay; Western Blot [6]
Representative Target(s) Regulated by This miRNA ATPase family AAA domain containing 2 (ATAD2) Target Info
ATAD2_HUMAN
B-cell translocation gene 1 protein (BTG1) Target Info
BTG1_HUMAN
miRNA Mature ID hsa-miR-103a-3p miRNA Info
miRNA Mature AC
MIMAT0000101
Sequence agcagcauuguacagggcuauga
miRNA Species Homo sapiens
Evidence Score (E-score) 2 +
1 Luciferase Reporter Assay [4]
2 Luciferase Reporter Assay [7]
Representative Target(s) Regulated by This miRNA Cyclic AMP-responsive element-binding protein (CREB1) Target Info
CREB1_HUMAN
Cyclin-dependent kinase 2 (CDK2) Target Info
CDK2_HUMAN
miRNA Mature ID hsa-miR-200c-3p miRNA Info
miRNA Mature AC
MIMAT0000617
Sequence uaauacugccggguaaugaugga
miRNA Species Homo sapiens
Regulation Mechanism miR-200c mediated inhibition of cell proliferation was through directly targeting CDK2. [8]
Evidence Score (E-score) 1 +
1 Immunohistochemistry; Luciferase Reporter Assay; Western Blot [8]
Representative Target(s) Regulated by This miRNA Activin receptor type IIB (ACVR2B) Target Info
AVR2B_HUMAN
Apoptosis regulator Bcl-2 (BCL-2) Target Info
BCL2_HUMAN
miRNA Mature ID hsa-miR-20b-5p miRNA Info
miRNA Mature AC
MIMAT0001413
Sequence caaagugcucauagugcagguag
miRNA Species Homo sapiens
Regulation Mechanism Overexpression of miR-20b inhibits the expression of CDK2. [9]
Evidence Score (E-score) 1 +
1 Immunoblot; Immunoprecipitation [9]
Representative Target(s) Regulated by This miRNA Cyclin-dependent kinase 2 (CDK2) Target Info
CDK2_HUMAN
Cyclin-dependent kinase 6 (CDK6) Target Info
CDK6_HUMAN
miRNA Mature ID hsa-miR-29a-3p miRNA Info
miRNA Mature AC
MIMAT0000086
Sequence uagcaccaucugaaaucgguua
miRNA Species Homo sapiens
Regulation Mechanism Enforced miR-29a-3p expression inhibited cell proliferation by reducing the expression of CDK2. [10]
Evidence Score (E-score) 1 +
1 qRT-PCR; Western Blot [10]
Representative Target(s) Regulated by This miRNA Apoptosis regulator Bcl-2 (BCL-2) Target Info
BCL2_HUMAN
Aryl hydrocarbon receptor (AHR) Target Info
AHR_HUMAN
miRNA Mature ID hsa-miR-302a-3p miRNA Info
miRNA Mature AC
MIMAT0000684
Sequence uaagugcuuccauguuuugguga
miRNA Species Homo sapiens
Regulation Mechanism CDK2, which is a target of miR-302a, were suppressed by treatment with SAHA and DzNep, leading to apoptosis, cell cycle arrest and reduced migration of AGS and HepG2 cells. [11]
Evidence Score (E-score) 1 +
1 Western Blot [11]
Representative Target(s) Regulated by This miRNA ATP-binding cassette transporter A1 (ABCA1) Target Info
ABCA1_HUMAN
Cyclin-dependent kinase 1 (CDK1) Target Info
CDK1_HUMAN
miRNA Mature ID hsa-miR-302b-3p miRNA Info
miRNA Mature AC
MIMAT0000715
Sequence uaagugcuuccauguuuuaguag
miRNA Species Homo sapiens
Regulation Mechanism miR-302b promoted the proliferation of gastric cancer cells through upregulation of CDK2, thereby inhibiting ERK pathway, which can in turn inhibit the promoting ability of miR-302b on proliferation. [12]
Evidence Score (E-score) 1 +
1 Luciferase Reporter Assay; Western Blot [12]
Representative Target(s) Regulated by This miRNA Cyclin-dependent kinase 2 (CDK2) Target Info
CDK2_HUMAN
Dihydrothymine dehydrogenase (DPYD) Target Info
DPYD_HUMAN
miRNA Mature ID hsa-miR-524-5p miRNA Info
miRNA Mature AC
MIMAT0002849
Sequence cuacaaagggaagcacuuucuc
miRNA Species Homo sapiens
Regulation Mechanism miR-524-5p regulates CDK2. [13]
Evidence Score (E-score) 1 +
1 Luciferase Reporter Assay [13]
Representative Target(s) Regulated by This miRNA Cyclin-dependent kinase 2 (CDK2) Target Info
CDK2_HUMAN
Dual specificity protein kinase TTK (MPS1) Target Info
TTK_HUMAN
miRNA Mature ID hsa-miR-638 miRNA Info
miRNA Mature AC
MIMAT0003308
Sequence agggaucgcgggcggguggcggccu
miRNA Species Homo sapiens
Regulation Mechanism miR-638 regulates CDK2 by binding both of two sites in the 3'UTR. [14]
Evidence Score (E-score) 1 +
1 Luciferase Reporter Assay; Western Blot [14]
Representative Target(s) Regulated by This miRNA Cellular tumor antigen p53 (TP53) Target Info
P53_HUMAN
Cyclin-dependent kinase 2 (CDK2) Target Info
CDK2_HUMAN
miRNA Mature ID hsa-miR-892b miRNA Info
miRNA Mature AC
MIMAT0004918
Sequence cacuggcuccuuucuggguaga
miRNA Species Homo sapiens
Evidence Score (E-score) 1 +
1 Immunoblot [15]
Representative Target(s) Regulated by This miRNA Cyclin-dependent kinase 2 (CDK2) Target Info
CDK2_HUMAN
Cyclin-dependent kinase 6 (CDK6) Target Info
CDK6_HUMAN
miRNA Mature ID hsa-miR-885-5p miRNA Info
miRNA Mature AC
MIMAT0004947
Sequence uccauuacacuacccugccucu
miRNA Species Homo sapiens
Regulation Mechanism miR-885-5p downregulates cyclin-dependent kinase (CDK2). [16]
Evidence Score (E-score) 1 +
1 Luciferase Reporter Assay; Northern Blot; Western Blot [16]
Representative Target(s) Regulated by This miRNA Beta-catenin (CTNNB1) Target Info
CTNB1_HUMAN
Caspase-3 (CASP3) Target Info
CASP3_HUMAN
miRNA Mature ID hsa-miR-5582-5p miRNA Info
miRNA Mature AC
MIMAT0022279
Sequence uaggcacacuuaaaguuauagc
miRNA Species Homo sapiens
Regulation Mechanism CDK2 was a direct target of miR-5582-5p. [17]
Evidence Score (E-score) 1 +
1 Luciferase Reporter Assay; Western Blot [17]
Representative Target(s) Regulated by This miRNA Cyclin-dependent kinase 2 (CDK2) Target Info
CDK2_HUMAN
References  Top
REF 1 miR-223 functions as a potent tumor suppressor of the Lewis lung carcinoma cell line by targeting insulin-like growth factor-1 receptor and cyclin-... Oncol Lett. 2013 Aug;6(2):359-366.
REF 2 Upregulation of miR-223 in the rat liver inhibits proliferation of hepatocytes under simulated microgravity. Exp Mol Med. 2017 Jun 23;49(6):e348.
REF 3 MicroRNA miR-302 inhibits the tumorigenecity of human pluripotent stem cells by coordinate suppression of the CDK2 and CDK4/6 cell cycle pathways. Cancer Res. 2010 Nov 15;70(22):9473-82.
REF 4 Global microRNA characterization reveals that miR-103 is involved in IGF-1 stimulated mouse intestinal cell proliferation. PLoS One. 2010 Sep 23;5(9):e12976.
REF 5 MicroRNA-372 is down-regulated and targets cyclin-dependent kinase 2 (CDK2) and cyclin A1 in human cervical cancer, which may contribute to tumorigenesis. J Biol Chem. 2011 Jul 22;286(29):25556-63.
REF 6 CUL4B promotes replication licensing by up-regulating the CDK2-CDC6 cascade. J Cell Biol. 2013 Mar 18;200(6):743-56.
REF 7 Regulatory effects of lncRNA ATB targeting miR-200c on proliferation and apoptosis of colorectal cancer cells. J Cell Biochem. 2019 Jun 21.
REF 8 miR-200c Targets CDK2 and Suppresses Tumorigenesis in Renal Cell Carcinoma. Mol Cancer Res. 2015 Dec;13(12):1567-77.
REF 9 MicroRNA-20b inhibits the proliferation, migration and invasion of bladder cancer EJells via the targeting of cellycle regulation and Sp-1-mediated MMP-2 expression. Oncol Rep. 2015 Sep;34(3):1605-12.
REF 10 Reduced miR-29a-3p expression is linked to the cell proliferation and cell migration in gastric cancer. World J Surg Oncol. 2015 Mar 12;13:101.
REF 11 Inhibitors of enhancer of zeste homolog 2 (EZH2) activate tumor-suppressor microRNAs in human cancer cells. Oncogenesis. 2014 May 26;3:e104.
REF 12 miR-302b regulates cell cycles by targeting CDK2 via ERK signaling pathway in gastric cancer. Cancer Med. 2016 Sep;5(9):2302-13.
REF 13 Comprehensive analysis of the functional microRNA-mRNA regulatory network identifies miRNA signatures associated with glioma malignant progression. Nucleic Acids Res. 2013 Dec;41(22):e203.
REF 14 miR-638 regulates differentiation and proliferation in leukemic cells by targeting cyclin-dependent kinase 2. J Biol Chem. 2015 Jan 16;290(3):1818-28.
REF 15 MicroRNA-892b influences proliferation, migration and invasion of bladder cancer cells by mediating the p19ARF/cyclin D1/CDK6 and Sp-1/MMP-9 pathways. Oncol Rep. 2016 Oct;36(4):2313-20.
REF 16 MicroRNA miR-885-5p targets CDK2 and MCM5, activates p53 and inhibits proliferation and survival. Cell Death Differ. 2011 Jun;18(6):974-84.
REF 17 Novel miR-5582-5p functions as a tumor suppressor by inducing apoptosis and cell cycle arrest in cancer cells through direct targeting of GAB1, SHC1, and CDK2. Biochim Biophys Acta. 2016 Oct;1862(10):1926-37.

If You Find Any Error in Data or Bug in Web Service, Please Kindly Report It to Dr. Zhou and Dr. Zhang.