Target Regulator(s) Information (MicroRNA)

Content Navigation (  All   None )                                      
Target General Information
The microRNAs (miRNAs) Regulating This Target
References
Target General Information  Top
Target ID T73475 Target Info
Target Name Matrix metalloproteinase-7 (MMP-7)
Synonyms Uterine metalloproteinase; Pump-1 protease; PUMP1; Matrin; Matrilysin; MPSL1
Target Type Successful Target
Gene Name MMP7
Biochemical Class Peptidase
UniProt ID
P09237
The microRNAs (miRNAs) Regulating This Target  Top
miRNA Mature ID hsa-miR-148a-3p miRNA Info
miRNA Mature AC
MIMAT0000243
Sequence ucagugcacuacagaacuuugu
miRNA Species Homo sapiens
Evidence Score (E-score) 2 +
1 In Situ Hybridization; Western Blot; Luciferase Reporter Assay [1]
2 qPCR [2]
Representative Target(s) Regulated by This miRNA Activated leukocyte cell adhesionmolecule (ALCAM) Target Info
CD166_HUMAN
Activin receptor-like kinase 2 (ALK-2) Target Info
ACVR1_HUMAN
miRNA Mature ID hsa-miR-34a-5p miRNA Info
miRNA Mature AC
MIMAT0000255
Sequence uggcagugucuuagcugguugu
miRNA Species Homo sapiens
Regulation Mechanism miRNA-34 inhibits EGFR signaling via downstream PI3K signaling cascades to regulate MMP7 expression in gastric carcinoma. [3]
Evidence Score (E-score) 2 +
1 ELISA [3]
2 Western Blot [4]
Representative Target(s) Regulated by This miRNA Amphiregulin (AREG) Target Info
AREG_HUMAN
Androgen receptor (AR) Target Info
ANDR_HUMAN
miRNA Mature ID hsa-miR-126-3p miRNA Info
miRNA Mature AC
MIMAT0000445
Sequence ucguaccgugaguaauaaugcg
miRNA Species Homo sapiens
Regulation Mechanism miR-126 directly regulate MMP7 target gene. [5]
Evidence Score (E-score) 1 +
1 Luciferase Reporter Assay [5]
Representative Target(s) Regulated by This miRNA Adrenomedullin (ADM) Target Info
ADML_HUMAN
Angiopoietin 1 receptor (TEK) Target Info
TIE2_HUMAN
miRNA Mature ID hsa-miR-126-5p miRNA Info
miRNA Mature AC
MIMAT0000444
Sequence cauuauuacuuuugguacgcg
miRNA Species Homo sapiens
Regulation Mechanism miR-126 directly regulate MMP7 target gene. [5]
Evidence Score (E-score) 1 +
1 Luciferase Reporter Assay [5]
Representative Target(s) Regulated by This miRNA Matrix metalloproteinase-7 (MMP-7) Target Info
MMP7_HUMAN
Proto-oncogene c-Crk (c-Crk) Target Info
CRK_HUMAN
miRNA Mature ID hsa-miR-203a-5p miRNA Info
miRNA Mature AC
MIMAT0031890
Sequence agugguucuuaacaguucaacaguu
miRNA Species Homo sapiens
Regulation Mechanism miR203 inhibits matrix metalloproteinase 7 (MMP7). [6]
Evidence Score (E-score) 1 +
1 Western Blot [6]
Representative Target(s) Regulated by This miRNA CDK inhibitor 1B p27Kip1 (CDKN1B) Target Info
CDN1B_HUMAN
Cyclin-dependent kinase 6 (CDK6) Target Info
CDK6_HUMAN
miRNA Mature ID hsa-miR-543 miRNA Info
miRNA Mature AC
MIMAT0004954
Sequence aaacauucgcggugcacuucuu
miRNA Species Homo sapiens
Regulation Mechanism miR-543 targets 3'UTR of MMP7 mRNA in OC cells. [7]
Evidence Score (E-score) 1 +
1 ELISA; Luciferase Reporter Assay; Western Blot [7]
Representative Target(s) Regulated by This miRNA Focal adhesion kinase 1 (FAK) Target Info
FAK1_HUMAN
High mobility group protein HMGI-C (HMGA2) Target Info
HMGA2_HUMAN
miRNA Mature ID hsa-miR-489-3p miRNA Info
miRNA Mature AC
MIMAT0002805
Sequence gugacaucacauauacggcagc
miRNA Species Homo sapiens
Regulation Mechanism MMP7 was a downstream molecule of miR-489 in HCC. [8]
Evidence Score (E-score) 1 +
1 Immunohistochemistry; Luciferase Reporter Assay; Western Blot [8]
Representative Target(s) Regulated by This miRNA Matrix metalloproteinase-7 (MMP-7) Target Info
MMP7_HUMAN
Protein-tyrosine phosphatase SHP-2 (PTPN11) Target Info
PTN11_HUMAN
References  Top
REF 1 MicroRNA-148a is downregulated in gastric cancer, targets MMP7, and indicates tumor invasiveness and poor prognosis. Cancer Sci. 2014 Feb;105(2):236-43.
REF 2 Involvement of microRNAs-MMPs-E-cadherin in the migration and invasion of gastric cancer cells infected with Helicobacter pylori. Exp Cell Res. 2018 Jun 15;367(2):196-204.
REF 3 MiRNA-34a inhibits EGFR-signaling-dependent MMP7 activation in gastric cancer. Tumour Biol. 2014 Oct;35(10):9801-6.
REF 4 Delphinidin suppresses breast carcinogenesis through the HOTAIR/microRNA-34a axis. Cancer Sci. 2019 Oct;110(10):3089-3097.
REF 5 miR-126&126* restored expressions play a tumor suppressor role by directly regulating ADAM9 and MMP7 in melanoma. PLoS One. 2013;8(2):e56824.
REF 6 MicroRNA-203 Regulates Growth and Metastasis of Breast Cancer. Cell Physiol Biochem. 2015;37(1):35-42.
REF 7 Placental growth factor promotes metastases of ovarian cancer through MiR-543-regulated MMP7. Cell Physiol Biochem. 2015;37(3):1104-12.
REF 8 microRNA-489 Plays an Anti-Metastatic Role in Human Hepatocellular Carcinoma by Targeting Matrix Metalloproteinase-7. Transl Oncol. 2017 Apr;10(2):211-220.

If You Find Any Error in Data or Bug in Web Service, Please Kindly Report It to Dr. Zhou and Dr. Zhang.