The microRNAs (miRNAs) Regulating This Target |
Top |
miRNA Mature ID |
hsa-miR-125a-5p |
miRNA Info
|
miRNA Mature AC |
|
Sequence |
ucccugagacccuuuaaccuguga
|
miRNA Species |
Homo sapiens |
Evidence Score (E-score) |
2 |
+ |
1 |
Immunohistochemistry |
[1] |
2 |
Luciferase Reporter Assay; Western Blot |
[2] |
Representative Target(s) Regulated by This miRNA |
Apoptosis regulator BAK (BAK)
|
Target Info
|
|
Apoptosis regulator Bcl-2 (BCL-2)
|
Target Info
|
|
miRNA Mature ID |
hsa-miR-23c |
miRNA Info
|
miRNA Mature AC |
|
Sequence |
aucacauugccagugauuaccc
|
miRNA Species |
Homo sapiens |
Regulation Mechanism |
MALAT1 expression was substantially increased but miR-23c was decreased in streptozotocin-induced diabetic rats and in high-glucose-treated HK-2 cells. |
[3] |
Evidence Score (E-score) |
2 |
+ |
1 |
Luciferase Reporter Assay |
[3] |
2 |
Luciferase Reporter Assay; Western Blot |
[3] |
Representative Target(s) Regulated by This miRNA |
ELAV-like protein 1 (ELAVL1)
|
Target Info
|
|
miRNA Mature ID |
hsa-miR-146a-5p |
miRNA Info
|
miRNA Mature AC |
|
Sequence |
ugagaacugaauuccauggguu
|
miRNA Species |
Homo sapiens |
Evidence Score (E-score) |
1 |
+ |
1 |
Immunoprecipitation; Luciferase Reporter Assay; qRT-PCR; Western Blot |
[4] |
Representative Target(s) Regulated by This miRNA |
Activation B7-1 antigen (CD80)
|
Target Info
|
|
Apoptosis mediating surface antigen FAS (FAS)
|
Target Info
|
|
miRNA Mature ID |
hsa-miR-296-5p |
miRNA Info
|
miRNA Mature AC |
|
Sequence |
agggcccccccucaauccugu
|
miRNA Species |
Homo sapiens |
Regulation Mechanism |
ELAVL1 as a direct target of miR-9. |
[5] |
Evidence Score (E-score) |
1 |
+ |
1 |
Luciferase Reporter Assay |
[5] |
Representative Target(s) Regulated by This miRNA |
Apoptosis regulator Bcl-2 (BCL-2)
|
Target Info
|
|
Bcl-2-binding component 3 (BBC3)
|
Target Info
|
|
miRNA Mature ID |
hsa-miR-519c-3p |
miRNA Info
|
miRNA Mature AC |
|
Sequence |
aaagugcaucuuuuuagaggau
|
miRNA Species |
Homo sapiens |
Evidence Score (E-score) |
1 |
+ |
1 |
qRT-PCR; Western Blot |
[6] |
Representative Target(s) Regulated by This miRNA |
ATP-binding cassette transporter G2 (ABCG2)
|
Target Info
|
|
ELAV-like protein 1 (ELAVL1)
|
Target Info
|
|
miRNA Mature ID |
hsa-miR-139-3p |
miRNA Info
|
miRNA Mature AC |
|
Sequence |
uggagacgcggcccuguuggagu
|
miRNA Species |
Homo sapiens |
Evidence Score (E-score) |
1 |
+ |
1 |
Luciferase Reporter Assay |
[7] |
Representative Target(s) Regulated by This miRNA |
ELAV-like protein 1 (ELAVL1)
|
Target Info
|
|
Matrix metalloproteinase-11 (MMP-11)
|
Target Info
|
|
miRNA Mature ID |
hsa-miR-519b-3p |
miRNA Info
|
miRNA Mature AC |
|
Sequence |
aaagugcauccuuuuagagguu
|
miRNA Species |
Homo sapiens |
Evidence Score (E-score) |
1 |
+ |
1 |
qRT-PCR; Western Blot |
[6] |
Representative Target(s) Regulated by This miRNA |
ELAV-like protein 1 (ELAVL1)
|
Target Info
|
|
Melanoma differentiation-associated protein 6 (CDKN1A)
|
Target Info
|
|