Target Regulator(s) Information (MicroRNA)

Content Navigation (  All   None )                                      
Target General Information
The microRNAs (miRNAs) Regulating This Target
References
Target General Information  Top
Target ID T80454 Target Info
Target Name T-lymphoma invasion and metastasis 1 (TIAM1)
Synonyms TIAM-1; T-lymphoma invasion and metastasis-inducing protein 1
Target Type Literature-reported Target
Gene Name TIAM1
UniProt ID
Q13009
The microRNAs (miRNAs) Regulating This Target  Top
miRNA Mature ID hsa-miR-21-5p miRNA Info
miRNA Mature AC
MIMAT0000076
Sequence uagcuuaucagacugauguuga
miRNA Species Homo sapiens
Regulation Mechanism TIAM1 is a target for miR-21. [2]
Evidence Score (E-score) 3 +
1 Luciferase Reporter Assay [1]
2 Luciferase Reporter Assay; Northern Blot [2]
3 Microarray; qRT-PCR [3]
Representative Target(s) Regulated by This miRNA Apoptosis antigen ligand (CD178) Target Info
TNFL6_HUMAN
Apoptosis regulator Bcl-2 (BCL-2) Target Info
BCL2_HUMAN
miRNA Mature ID hsa-miR-10a-5p miRNA Info
miRNA Mature AC
MIMAT0000253
Sequence uacccuguagauccgaauuugug
miRNA Species Homo sapiens
Evidence Score (E-score) 2 +
1 Dual Luciferase Reporter Assay [4]
2 Microarray [3]
Representative Target(s) Regulated by This miRNA AN1-type zinc finger protein 5 (ZFAND5) Target Info
ZFAN5_HUMAN
Brain-derived neurotrophic factor (BDNF) Target Info
BDNF_HUMAN
miRNA Mature ID hsa-miR-10b-5p miRNA Info
miRNA Mature AC
MIMAT0000254
Sequence uacccuguagaaccgaauuugug
miRNA Species Homo sapiens
Regulation Mechanism Tiam1 was the target of miR-10b in gastric cancer and miR-10b may act as a tumor suppressor by targeting Tiam1. [5]
Evidence Score (E-score) 2 +
1 Luciferase Reporter Assay; Western Blot [5]
2 Western Blot [6]
Representative Target(s) Regulated by This miRNA Cellular tumor antigen p53 (TP53) Target Info
P53_HUMAN
Cyclic AMP-responsive element-binding protein (CREB1) Target Info
CREB1_HUMAN
miRNA Mature ID hsa-miR-141-3p miRNA Info
miRNA Mature AC
MIMAT0000432
Sequence uaacacugucugguaaagaugg
miRNA Species Homo sapiens
Regulation Mechanism miR-141 functions as a tumor suppressor and inhibits the migration and invasion of HCC cells by targeting Tiam1. [7]
Evidence Score (E-score) 2 +
1 Luciferase Reporter Assay; Western Blot [7]
2 qRT-PCR [8]
Representative Target(s) Regulated by This miRNA Activin receptor type IIB (ACVR2B) Target Info
AVR2B_HUMAN
Bromodomain-containing protein 3 (BRD3) Target Info
BRD3_HUMAN
miRNA Mature ID hsa-miR-182-5p miRNA Info
miRNA Mature AC
MIMAT0000259
Sequence uuuggcaaugguagaacucacacu
miRNA Species Homo sapiens
Regulation Mechanism TIAM1 was a direct and functional target of miR-182 in osteosarcoma cells. Overexpression of miR-182 impaired TIAM1-induced inhibition of proliferation and invasion in osteosarcoma cells. [9]
Evidence Score (E-score) 1 +
1 Luciferase Reporter Assay; Western Blot [9]
Representative Target(s) Regulated by This miRNA Apoptosis regulator Bcl-2 (BCL-2) Target Info
BCL2_HUMAN
Brain-derived neurotrophic factor (BDNF) Target Info
BDNF_HUMAN
miRNA Mature ID hsa-miR-22-3p miRNA Info
miRNA Mature AC
MIMAT0000077
Sequence aagcugccaguugaagaacugu
miRNA Species Homo sapiens
Regulation Mechanism miR-22 acts as a tumor suppressor by targeting TIAM1 expression. [10]
Evidence Score (E-score) 1 +
1 Luciferase Reporter Assay; Western Blot [10]
Representative Target(s) Regulated by This miRNA 5-HT 2C receptor (HTR2C) Target Info
5HT2C_HUMAN
ATP-citrate synthase (ACLY) Target Info
ACLY_HUMAN
miRNA Mature ID hsa-miR-29c-3p miRNA Info
miRNA Mature AC
MIMAT0000681
Sequence uagcaccauuugaaaucgguua
miRNA Species Homo sapiens
Regulation Mechanism TIAM1 is a direct target of miR-29c and miR-29c binds to the TIAM1 3'UTR. [11]
Evidence Score (E-score) 1 +
1 Immunohistochemistry; Luciferase Reporter Assay; Western Blot [11]
Representative Target(s) Regulated by This miRNA Apoptosis regulator Bcl-2 (BCL-2) Target Info
BCL2_HUMAN
B7 homolog 3 (CD276) Target Info
CD276_HUMAN
miRNA Mature ID hsa-miR-31-5p miRNA Info
miRNA Mature AC
MIMAT0000089
Sequence aggcaagaugcuggcauagcu
miRNA Species Homo sapiens
Regulation Mechanism TIAM1 is a target for miR-31. [2]
Evidence Score (E-score) 1 +
1 Luciferase Reporter Assay; Northern Blot [2]
Representative Target(s) Regulated by This miRNA Cyclin-dependent kinase 1 (CDK1) Target Info
CDK1_HUMAN
Dickkopf-related protein 1 (DKK1) Target Info
DKK1_HUMAN
miRNA Mature ID hsa-miR-342-3p miRNA Info
miRNA Mature AC
MIMAT0000753
Sequence ucucacacagaaaucgcacccgu
miRNA Species Homo sapiens
Evidence Score (E-score) 1 +
1 Microarray [3]
Representative Target(s) Regulated by This miRNA DNA [cytosine-5]-methyltransferase 1 (DNMT1) Target Info
DNMT1_HUMAN
E2F transcription factor 1 (E2F1) Target Info
E2F1_HUMAN
References  Top
REF 1 Thyroid hormone regulation of miR-21 enhances migration and invasion of hepatoma. Cancer Res. 2013 Apr 15;73(8):2505-17.
REF 2 miR-21 and miR-31 converge on TIAM1 to regulate migration and invasion of colon carcinoma cells. J Biol Chem. 2010 Nov 12;285(46):35293-302.
REF 3 MicroRNA profiling in mucosal biopsies of eosinophilic esophagitis patients pre and post treatment with steroids and relationship with mRNA targets. PLoS One. 2012;7(7):e40676.
REF 4 Tumor-suppressive microRNA-10a inhibits cell proliferation and metastasis by targeting Tiam1 in esophageal squamous cell carcinoma. J Cell Biochem. 2018 Nov 13.
REF 5 DNA methylation downregulated mir-10b acts as a tumor suppressor in gastric cancer. Gastric Cancer. 2015 Jan;18(1):43-54.
REF 6 miR-10b Downregulated by DNA Methylation Acts as a Tumor Suppressor in HPV-Positive Cervical Cancer via Targeting Tiam1. Cell Physiol Biochem. 2018;51(4):1763-1777.
REF 7 MiR-141 suppresses the migration and invasion of HCC cells by targeting Tiam1. PLoS One. 2014 Feb 13;9(2):e88393.
REF 8 Tumor-suppressing miR-141 gene complex-loaded tissue-adhesive glue for the locoregional treatment of hepatocellular carcinoma. Theranostics. 2018 Jun 24;8(14):3891-3901.
REF 9 The Downregulation of MiR-182 Is Associated with the Growth and Invasion of Osteosarcoma Cells through the Regulation of TIAM1 Expression. PLoS One. 2015 May 14;10(5):e0121175.
REF 10 miRNA-22 suppresses colon cancer cell migration and invasion by inhibiting the expression of T-cell lymphoma invasion and metastasis 1 and matrix metalloproteinases 2 and 9. Oncol Rep. 2013 May;29(5):1932-8.
REF 11 MiR-29c suppresses invasion and metastasis by targeting TIAM1 in nasopharyngeal carcinoma. Cancer Lett. 2013 Feb 28;329(2):181-8.

If You Find Any Error in Data or Bug in Web Service, Please Kindly Report It to Dr. Zhou and Dr. Zhang.