Target General Information
Target ID T68251 Target Info
Target Name Matrix metalloproteinase-2 (MMP-2)
Synonyms TBE-1; Matrix metalloproteinase 2; CLG4A; 72 kDa type IV collagenase; 72 kDa gelatinase
Target Type Successful Target
Gene Name MMP2
Biochemical Class Peptidase
UniProt ID
The microRNAs (miRNAs) Regulating This Target
miRNA Mature ID hsa-miR-29a-3p miRNA Info
miRNA Mature AC
Sequence uagcaccaucugaaaucgguua
miRNA Species Homo sapiens
Evidence Score (E-score) 4 +
1 Luciferase Reporter Assay [1]
2 Luciferase Reporter Assay [2]
3 Luciferase Reporter Assay; Northern Blot; qRT-PCR; Western Blot [3]
4 Luciferase Reporter Assay; qRT-PCR; Western Blot [4]
Representative Target(s) Regulated by This miRNA Apoptosis regulator Bcl-2 (BCL-2) Target Info
Aryl hydrocarbon receptor (AHR) Target Info
miRNA Mature ID hsa-miR-29c-3p miRNA Info
miRNA Mature AC
Sequence uagcaccauuugaaaucgguua
miRNA Species Homo sapiens
Evidence Score (E-score) 4 +
1 Luciferase Reporter Assay [2]
2 Luciferase Reporter Assay; Northern Blot; qRT-PCR; Western Blot [3]
3 Luciferase Reporter Assay; qRT-PCR; Western Blot [5]
4 qRT-PCR; Western Blot [6]
Representative Target(s) Regulated by This miRNA Apoptosis regulator Bcl-2 (BCL-2) Target Info
B7 homolog 3 (CD276) Target Info
miRNA Mature ID hsa-miR-130b-3p miRNA Info
miRNA Mature AC
Sequence cagugcaaugaugaaagggcau
miRNA Species Homo sapiens
Regulation Mechanism miR-130b targets MMP2. The 3'UTR of MMP2 mRNA contains binding site for miR-130b. Dual-luciferase reporter assays showed that miR-130b significantly inhibited the activity of firefly luciferase that carried WT but not mutant 30-UTR of MMP2. [7]
Evidence Score (E-score) 2 +
1 Luciferase Reporter Assay; Western Blot [7]
2 Western Blot; Immunofluorescent Staining [8]
Representative Target(s) Regulated by This miRNA Acyl-CoA desaturase (SCD) Target Info
Cyclin A2 (CCNA2) Target Info
miRNA Mature ID hsa-miR-143-3p miRNA Info
miRNA Mature AC
Sequence ugagaugaagcacuguagcuc
miRNA Species Homo sapiens
Regulation Mechanism Intervention with miR-143mimic, the mRNA and protein expression levels of MMP-2 was decreased significantly. [9]
Evidence Score (E-score) 2 +
1 qRT-PCR; Western Blot [9]
2 RT-PCR [10]
Representative Target(s) Regulated by This miRNA Apoptosis regulator Bcl-2 (BCL-2) Target Info
Connective tissue growth factor (CTGF) Target Info
miRNA Mature ID hsa-miR-203a-5p miRNA Info
miRNA Mature AC
Sequence agugguucuuaacaguucaacaguu
miRNA Species Homo sapiens
Evidence Score (E-score) 2 +
1 Western Blot [11]
2 Western Blot [12]
Representative Target(s) Regulated by This miRNA CDK inhibitor 1B p27Kip1 (CDKN1B) Target Info
Cyclin-dependent kinase 6 (CDK6) Target Info
miRNA Mature ID hsa-miR-221-3p miRNA Info
miRNA Mature AC
Sequence agcuacauugucugcuggguuuc
miRNA Species Homo sapiens
Regulation Mechanism miR-221 restored Gem sensitivity to HuH28 cells by suppressing MMP-2. [14]
Evidence Score (E-score) 2 +
1 Dual Luciferase Reporter Assay; Western Blot; RT-PCR [13]
2 Western Blot [14]
Representative Target(s) Regulated by This miRNA Bcl-2-binding component 3 (BBC3) Target Info
Beclin-1 (BECN1) Target Info
miRNA Mature ID hsa-miR-338-3p miRNA Info
miRNA Mature AC
Sequence uccagcaucagugauuuuguug
miRNA Species Homo sapiens
Evidence Score (E-score) 2 +
1 Western Blot; qRT-PCR [15]
2 Western Blot; RT-PCR [16]
Representative Target(s) Regulated by This miRNA G1/S-specific cyclin-D1 (CCND1) Target Info
Hypoxia-inducible factor 1 alpha (HIF-1A) Target Info
miRNA Mature ID hsa-miR-451a miRNA Info
miRNA Mature AC
Sequence aaaccguuaccauuacugaguu
miRNA Species Homo sapiens
Evidence Score (E-score) 2 +
1 qRT-PCR; Western Blot [17]
2 qRT-PCR; Western Blot [18]
Representative Target(s) Regulated by This miRNA Apoptosis regulator Bcl-2 (BCL-2) Target Info
Extracellular signal-regulated kinase 2 (ERK2) Target Info
miRNA Mature ID hsa-miR-520g-3p miRNA Info
miRNA Mature AC
Sequence acaaagugcuucccuuuagagugu
miRNA Species Homo sapiens
Regulation Mechanism miR-520g mimic reduced the relative luciferase activity of the wide type MMP2 vector but not of the mutated MMP2 vector. [19]
Evidence Score (E-score) 2 +
1 In Situ Hybridization; Luciferase Reporter Assay; Western Blot [19]
2 Reporter Assay [20]
Representative Target(s) Regulated by This miRNA Matrix metalloproteinase-2 (MMP-2) Target Info
Vascular endothelial growth factor A (VEGFA) Target Info
miRNA Mature ID hsa-miR-106b-5p miRNA Info
miRNA Mature AC
Sequence uaaagugcugacagugcagau
miRNA Species Homo sapiens
Regulation Mechanism Matrix metalloproteinase 2 (MMP2) is the direct target of miR-106b. [21]
Evidence Score (E-score) 1 +
1 Luciferase Reporter Assay [21]
Representative Target(s) Regulated by This miRNA Amyloid beta A4 protein (APP) Target Info
Apoptosis mediating surface antigen FAS (FAS) Target Info
miRNA Mature ID hsa-miR-17-5p miRNA Info
miRNA Mature AC
Sequence caaagugcuuacagugcagguag
miRNA Species Homo sapiens
Evidence Score (E-score) 1 +
1 Western Blot [22]
Representative Target(s) Regulated by This miRNA Amyloid beta A4 protein (APP) Target Info
Apoptosis mediating surface antigen FAS (FAS) Target Info
miRNA Mature ID hsa-miR-21-5p miRNA Info
miRNA Mature AC
Sequence uagcuuaucagacugauguuga
miRNA Species Homo sapiens
Evidence Score (E-score) 1 +
1 qRT-PCR [23]
Representative Target(s) Regulated by This miRNA Apoptosis antigen ligand (CD178) Target Info
Apoptosis regulator Bcl-2 (BCL-2) Target Info
miRNA Mature ID hsa-miR-452-5p miRNA Info
miRNA Mature AC
Sequence aacuguuugcagaggaaacuga
miRNA Species Homo sapiens
Evidence Score (E-score) 1 +
1 Microarray [24]
Representative Target(s) Regulated by This miRNA CDK inhibitor 1B p27Kip1 (CDKN1B) Target Info
Dihydropyrimidinase related protein 2 (DPYSL2) Target Info
miRNA Mature ID hsa-miR-491-5p miRNA Info
miRNA Mature AC
Sequence aguggggaacccuuccaugagg
miRNA Species Homo sapiens
Regulation Mechanism miR-491 is involved in the expressions of MMP2 in hepatocellular carcinoma (HCC) cell lines. [25]
Evidence Score (E-score) 1 +
1 Immunohistochemistry; Western Blot [25]
Representative Target(s) Regulated by This miRNA Apoptosis regulator Bcl-xL (BCL-xL) Target Info
Cellular tumor antigen p53 (TP53) Target Info
miRNA Mature ID hsa-miR-519d-3p miRNA Info
miRNA Mature AC
Sequence caaagugccucccuuuagagug
miRNA Species Homo sapiens
Regulation Mechanism MMP-2 is a direct target of miR-519d-3p. [26]
Evidence Score (E-score) 1 +
1 Luciferase Reporter Assay [26]
Representative Target(s) Regulated by This miRNA Calcium-release activated calcium channel (CRACM) Target Info
E2F transcription factor 1 (E2F1) Target Info
miRNA Mature ID hsa-miR-524-5p miRNA Info
miRNA Mature AC
Sequence cuacaaagggaagcacuuucuc
miRNA Species Homo sapiens
Evidence Score (E-score) 1 +
1 qRT-PCR; Western Blot [27]
Representative Target(s) Regulated by This miRNA Cyclin-dependent kinase 2 (CDK2) Target Info
Dual specificity protein kinase TTK (MPS1) Target Info
miRNA Mature ID hsa-miR-708-5p miRNA Info
miRNA Mature AC
Sequence aaggagcuuacaaucuagcuggg
miRNA Species Homo sapiens
Regulation Mechanism Overexpression of miR-708 reduced the expression of MMP2. [28]
Evidence Score (E-score) 1 +
1 Western Blot [28]
Representative Target(s) Regulated by This miRNA Apoptosis inhibitor survivin (BIRC5) Target Info
Apoptosis regulator Bcl-2 (BCL-2) Target Info
miRNA Mature ID hsa-miR-302a-5p miRNA Info
miRNA Mature AC
Sequence acuuaaacguggauguacuugcu
miRNA Species Homo sapiens
Regulation Mechanism Overexpression of miR-942 resulted in the increased mRNA levels of MMP-2. [29]
Evidence Score (E-score) 1 +
1 ELISA; Western Blot [29]
Representative Target(s) Regulated by This miRNA Matrix metalloproteinase-2 (MMP-2) Target Info
Matrix metalloproteinase-9 (MMP-9) Target Info
miRNA Mature ID hsa-miR-767-5p miRNA Info
miRNA Mature AC
Sequence ugcaccaugguugucugagcaug
miRNA Species Homo sapiens
Evidence Score (E-score) 1 +
1 Luciferase Reporter Assay [2]
Representative Target(s) Regulated by This miRNA Lysyl oxidase (LOX) Target Info
Matrix metalloproteinase-2 (MMP-2) Target Info
References
REF 1 Different regulation of miR-29a-3p in glomeruli and tubules in an experimental model of angiotensin II-dependent hypertension: potential role in renal fibrosis. Clin Exp Pharmacol Physiol. 2016 Mar;43(3):335-42.
REF 2 A miRNA-regulatory network explains how dysregulated miRNAs perturb oncogenic processes across diverse cancers. Genome Res. 2012 Nov;22(11):2302-14.
REF 3 Characterization of microRNA-29 family expression and investigation of their mechanistic roles in gastric cancer. Carcinogenesis. 2014 Feb;35(2):497-506.
REF 4 MicroRNA-29a upregulates MMP2 in oral squamous cell carcinoma to promote cancer invasion and anti-apoptosis. Biomed Pharmacother. 2014 Feb;68(1):13-9.
REF 5 miRNA-29c suppresses lung cancer cell adhesion to extracellular matrix and metastasis by targeting integrin 1 and matrix metalloproteinase2 (MMP2). PLoS One. 2013 Aug 6;8(8):e70192.
REF 6 MicroRNA profiling of peripheral nerve sheath tumours identifies miR-29c as a tumour suppressor gene involved in tumour progression. Br J Cancer. 2013 Mar 5;108(4):964-72.
REF 7 MiR-130b suppresses prostate cancer metastasis through down-regulation of MMP2. Mol Carcinog. 2015 Nov;54(11):1292-300.
REF 8 MicroRNA-130b functions as an oncomiRNA in non-small cell lung cancer by targeting tissue inhibitor of metalloproteinase-2. Sci Rep. 2019 May 6;9(1):6956.
REF 9 miR-143 down-regulates TLR2 expression in hepatoma cells and inhibits hepatoma cell proliferation and invasion. Int J Clin Exp Pathol. 2015 Oct 1;8(10):12738-47.
REF 10 [miR-143 inhibits proliferation and invasion of hepatocellular carcinoma cells via down-regulation of TLR2 expression]. Xi Bao Yu Fen Zi Mian Yi Xue Za Zhi. 2014 Oct;30(10):1076-9.
REF 11 MicroRNA-203 Regulates Growth and Metastasis of Breast Cancer. Cell Physiol Biochem. 2015;37(1):35-42.
REF 12 MicroRNA-203 Modulates the Radiation Sensitivity of Human Malignant Glioma Cells. Int J Radiat Oncol Biol Phys. 2016 Feb 1;94(2):412-20.
REF 13 miR-221/222 induces pancreatic cancer progression through the regulation of matrix metalloproteinases. Oncotarget. 2015 Jun 10;6(16):14153-64.
REF 14 miR-29b, miR-205 and miR-221 enhance chemosensitivity to gemcitabine in HuH28 human cholangiocarcinoma cells. PLoS One. 2013 Oct 17;8(10):e77623.
REF 15 miR-338-3p suppresses invasion of liver cancer cell by targeting smoothened. J Pathol. 2011 Nov;225(3):463-72.
REF 16 MicroRNA-338-3p suppresses tumor growth of esophageal squamous cell carcinoma in vitro and in vivo. Mol Med Rep. 2015 Sep;12(3):3951-3957.
REF 17 Propofol inhibits proliferation and accelerates apoptosis of human gastric cancer cells by regulation of microRNA-451 and MMP-2 expression. Genet Mol Res. 2016 Apr 4;15(2).
REF 18 MiRNA-451 plays a role as tumor suppressor in human glioma cells. Brain Res. 2010 Nov 4;1359:14-21.
REF 19 Elevated microRNA-520g in pre-eclampsia inhibits migration and invasion of trophoblasts. Placenta. 2017 Mar;51:70-75.
REF 20 A microRNA-520 mirSNP at the MMP2 gene influences susceptibility to endometriosis in Chinese women. J Hum Genet. 2013 Apr;58(4):202-9.
REF 21 Downregulation of miR-106b induced breast cancer cell invasion and motility in association with overexpression of matrix metalloproteinase 2. Cancer Sci. 2014 Jan;105(1):18-25.
REF 22 miR-17-5p Promotes migration of human hepatocellular carcinoma cells through the p38 mitogen-activated protein kinase-heat shock protein 27 pathway. Hepatology. 2010 May;51(5):1614-23.
REF 23 MicroRNA-21 modulates biological functions of pancreatic cancer cells including their proliferation, invasion, and chemoresistance. Mol Cancer Ther. 2009 May;8(5):1067-74.
REF 24 Cigarette smoking decreases global microRNA expression in human alveolar macrophages. PLoS One. 2012;7(8):e44066.
REF 25 MicroRNA-491 is involved in metastasis of hepatocellular carcinoma by inhibitions of matrix metalloproteinase and epithelial to mesenchymal transition. Liver Int. 2013 Sep;33(8):1271-80.
REF 26 MiR-519d-3p suppresses invasion and migration of trophoblast cells via targeting MMP-2. PLoS One. 2015 Mar 24;10(3):e0120321.
REF 27 MicroRNA-524-5p suppresses the growth and invasive abilities of gastric cancer cells. Oncol Lett. 2016 Mar;11(3):1926-1932.
REF 28 miR-708 acts as a tumor suppressor in human glioblastoma cells. Oncol Rep. 2013 Aug;30(2):870-6.
REF 29 Up-regulation of microRNA-302a inhibited the proliferation and invasion of colorectal cancer cells by regulation of the MAPK and PI3K/Akt signaling... Int J Clin Exp Pathol. 2015 May 1;8(5):4481-91.

If You Find Any Error in Data or Bug in Web Service, Please Kindly Report It to Dr. Wang and Dr. Li.