Target Regulator(s) Information (MicroRNA)

Target General Information
Target ID	T68251		Target Info
Target Name	Matrix metalloproteinase-2 (MMP-2)
Synonyms	TBE-1; Matrix metalloproteinase 2; CLG4A; 72 kDa type IV collagenase; 72 kDa gelatinase
Target Type	Successful Target
Gene Name	MMP2
Biochemical Class	Peptidase
UniProt ID	P08253
The microRNAs (miRNAs) Regulating This Target
miRNA Mature ID	hsa-miR-29a-3p		miRNA Info
miRNA Mature AC	MIMAT0000086
Sequence	uagcaccaucugaaaucgguua
miRNA Species	Homo sapiens
Evidence Score (E-score)	4		+
1	Luciferase Reporter Assay		[1]
2	Luciferase Reporter Assay		[2]
3	Luciferase Reporter Assay; Northern Blot; qRT-PCR; Western Blot		[3]
4	Luciferase Reporter Assay; qRT-PCR; Western Blot		[4]
Representative Target(s) Regulated by This miRNA	Apoptosis regulator Bcl-2 (BCL-2)	Target Info	BCL2_HUMAN
Representative Target(s) Regulated by This miRNA	Aryl hydrocarbon receptor (AHR)	Target Info	AHR_HUMAN
miRNA Mature ID	hsa-miR-29c-3p		miRNA Info
miRNA Mature AC	MIMAT0000681
Sequence	uagcaccauuugaaaucgguua
miRNA Species	Homo sapiens
Evidence Score (E-score)	4		+
1	Luciferase Reporter Assay		[2]
2	Luciferase Reporter Assay; Northern Blot; qRT-PCR; Western Blot		[3]
3	Luciferase Reporter Assay; qRT-PCR; Western Blot		[5]
4	qRT-PCR; Western Blot		[6]
Representative Target(s) Regulated by This miRNA	Apoptosis regulator Bcl-2 (BCL-2)	Target Info	BCL2_HUMAN
Representative Target(s) Regulated by This miRNA	B7 homolog 3 (CD276)	Target Info	CD276_HUMAN
miRNA Mature ID	hsa-miR-130b-3p		miRNA Info
miRNA Mature AC	MIMAT0000691
Sequence	cagugcaaugaugaaagggcau
miRNA Species	Homo sapiens
Regulation Mechanism	miR-130b targets MMP2. The 3'UTR of MMP2 mRNA contains binding site for miR-130b. Dual-luciferase reporter assays showed that miR-130b significantly inhibited the activity of firefly luciferase that carried WT but not mutant 30-UTR of MMP2.		[7]
Evidence Score (E-score)	2		+
1	Luciferase Reporter Assay; Western Blot		[7]
2	Western Blot; Immunofluorescent Staining		[8]
Representative Target(s) Regulated by This miRNA	Acyl-CoA desaturase (SCD)	Target Info	ACOD_HUMAN
Representative Target(s) Regulated by This miRNA	Cyclin A2 (CCNA2)	Target Info	CCNA2_HUMAN
miRNA Mature ID	hsa-miR-143-3p		miRNA Info
miRNA Mature AC	MIMAT0000435
Sequence	ugagaugaagcacuguagcuc
miRNA Species	Homo sapiens
Regulation Mechanism	Intervention with miR-143mimic, the mRNA and protein expression levels of MMP-2 was decreased significantly.		[9]
Evidence Score (E-score)	2		+
1	qRT-PCR; Western Blot		[9]
2	RT-PCR		[10]
Representative Target(s) Regulated by This miRNA	Apoptosis regulator Bcl-2 (BCL-2)	Target Info	BCL2_HUMAN
Representative Target(s) Regulated by This miRNA	Connective tissue growth factor (CTGF)	Target Info	CTGF_HUMAN
miRNA Mature ID	hsa-miR-203a-5p		miRNA Info
miRNA Mature AC	MIMAT0031890
Sequence	agugguucuuaacaguucaacaguu
miRNA Species	Homo sapiens
Evidence Score (E-score)	2		+
1	Western Blot		[11]
2	Western Blot		[12]
Representative Target(s) Regulated by This miRNA	CDK inhibitor 1B p27Kip1 (CDKN1B)	Target Info	CDN1B_HUMAN
Representative Target(s) Regulated by This miRNA	Cyclin-dependent kinase 6 (CDK6)	Target Info	CDK6_HUMAN
miRNA Mature ID	hsa-miR-221-3p		miRNA Info
miRNA Mature AC	MIMAT0000278
Sequence	agcuacauugucugcuggguuuc
miRNA Species	Homo sapiens
Regulation Mechanism	miR-221 restored Gem sensitivity to HuH28 cells by suppressing MMP-2.		[14]
Evidence Score (E-score)	2		+
1	Dual Luciferase Reporter Assay; Western Blot; RT-PCR		[13]
2	Western Blot		[14]
Representative Target(s) Regulated by This miRNA	Bcl-2-binding component 3 (BBC3)	Target Info	BBC3_HUMAN
Representative Target(s) Regulated by This miRNA	Beclin-1 (BECN1)	Target Info	BECN1_HUMAN
miRNA Mature ID	hsa-miR-338-3p		miRNA Info
miRNA Mature AC	MIMAT0000763
Sequence	uccagcaucagugauuuuguug
miRNA Species	Homo sapiens
Evidence Score (E-score)	2		+
1	Western Blot; qRT-PCR		[15]
2	Western Blot; RT-PCR		[16]
Representative Target(s) Regulated by This miRNA	G1/S-specific cyclin-D1 (CCND1)	Target Info	CCND1_HUMAN
Representative Target(s) Regulated by This miRNA	Hypoxia-inducible factor 1 alpha (HIF-1A)	Target Info	HIF1A_HUMAN
miRNA Mature ID	hsa-miR-451a		miRNA Info
miRNA Mature AC	MIMAT0001631
Sequence	aaaccguuaccauuacugaguu
miRNA Species	Homo sapiens
Evidence Score (E-score)	2		+
1	qRT-PCR; Western Blot		[17]
2	qRT-PCR; Western Blot		[18]
Representative Target(s) Regulated by This miRNA	Apoptosis regulator Bcl-2 (BCL-2)	Target Info	BCL2_HUMAN
Representative Target(s) Regulated by This miRNA	Extracellular signal-regulated kinase 2 (ERK2)	Target Info	MK01_HUMAN
miRNA Mature ID	hsa-miR-520g-3p		miRNA Info
miRNA Mature AC	MIMAT0002858
Sequence	acaaagugcuucccuuuagagugu
miRNA Species	Homo sapiens
Regulation Mechanism	miR-520g mimic reduced the relative luciferase activity of the wide type MMP2 vector but not of the mutated MMP2 vector.		[19]
Evidence Score (E-score)	2		+
1	In Situ Hybridization; Luciferase Reporter Assay; Western Blot		[19]
2	Reporter Assay		[20]
Representative Target(s) Regulated by This miRNA	Matrix metalloproteinase-2 (MMP-2)	Target Info	MMP2_HUMAN
Representative Target(s) Regulated by This miRNA	Vascular endothelial growth factor A (VEGFA)	Target Info	VEGFA_HUMAN
miRNA Mature ID	hsa-miR-106b-5p		miRNA Info
miRNA Mature AC	MIMAT0000680
Sequence	uaaagugcugacagugcagau
miRNA Species	Homo sapiens
Regulation Mechanism	Matrix metalloproteinase 2 (MMP2) is the direct target of miR-106b.		[21]
Evidence Score (E-score)	1		+
1	Luciferase Reporter Assay		[21]
Representative Target(s) Regulated by This miRNA	Amyloid beta A4 protein (APP)	Target Info	A4_HUMAN
Representative Target(s) Regulated by This miRNA	Apoptosis mediating surface antigen FAS (FAS)	Target Info	TNR6_HUMAN
miRNA Mature ID	hsa-miR-17-5p		miRNA Info
miRNA Mature AC	MIMAT0000070
Sequence	caaagugcuuacagugcagguag
miRNA Species	Homo sapiens
Evidence Score (E-score)	1		+
1	Western Blot		[22]
Representative Target(s) Regulated by This miRNA	Amyloid beta A4 protein (APP)	Target Info	A4_HUMAN
Representative Target(s) Regulated by This miRNA	Apoptosis mediating surface antigen FAS (FAS)	Target Info	TNR6_HUMAN
miRNA Mature ID	hsa-miR-21-5p		miRNA Info
miRNA Mature AC	MIMAT0000076
Sequence	uagcuuaucagacugauguuga
miRNA Species	Homo sapiens
Evidence Score (E-score)	1		+
1	qRT-PCR		[23]
Representative Target(s) Regulated by This miRNA	Apoptosis antigen ligand (CD178)	Target Info	TNFL6_HUMAN
Representative Target(s) Regulated by This miRNA	Apoptosis regulator Bcl-2 (BCL-2)	Target Info	BCL2_HUMAN
miRNA Mature ID	hsa-miR-452-5p		miRNA Info
miRNA Mature AC	MIMAT0001635
Sequence	aacuguuugcagaggaaacuga
miRNA Species	Homo sapiens
Evidence Score (E-score)	1		+
1	Microarray		[24]
Representative Target(s) Regulated by This miRNA	CDK inhibitor 1B p27Kip1 (CDKN1B)	Target Info	CDN1B_HUMAN
Representative Target(s) Regulated by This miRNA	Dihydropyrimidinase related protein 2 (DPYSL2)	Target Info	DPYL2_HUMAN
miRNA Mature ID	hsa-miR-491-5p		miRNA Info
miRNA Mature AC	MIMAT0002807
Sequence	aguggggaacccuuccaugagg
miRNA Species	Homo sapiens
Regulation Mechanism	miR-491 is involved in the expressions of MMP2 in hepatocellular carcinoma (HCC) cell lines.		[25]
Evidence Score (E-score)	1		+
1	Immunohistochemistry; Western Blot		[25]
Representative Target(s) Regulated by This miRNA	Apoptosis regulator Bcl-xL (BCL-xL)	Target Info	B2CL1_HUMAN
Representative Target(s) Regulated by This miRNA	Cellular tumor antigen p53 (TP53)	Target Info	P53_HUMAN
miRNA Mature ID	hsa-miR-519d-3p		miRNA Info
miRNA Mature AC	MIMAT0002853
Sequence	caaagugccucccuuuagagug
miRNA Species	Homo sapiens
Regulation Mechanism	MMP-2 is a direct target of miR-519d-3p.		[26]
Evidence Score (E-score)	1		+
1	Luciferase Reporter Assay		[26]
Representative Target(s) Regulated by This miRNA	Calcium-release activated calcium channel (CRACM)	Target Info	CRCM1_HUMAN
Representative Target(s) Regulated by This miRNA	E2F transcription factor 1 (E2F1)	Target Info	E2F1_HUMAN
miRNA Mature ID	hsa-miR-524-5p		miRNA Info
miRNA Mature AC	MIMAT0002849
Sequence	cuacaaagggaagcacuuucuc
miRNA Species	Homo sapiens
Evidence Score (E-score)	1		+
1	qRT-PCR; Western Blot		[27]
Representative Target(s) Regulated by This miRNA	Cyclin-dependent kinase 2 (CDK2)	Target Info	CDK2_HUMAN
Representative Target(s) Regulated by This miRNA	Dual specificity protein kinase TTK (MPS1)	Target Info	TTK_HUMAN
miRNA Mature ID	hsa-miR-708-5p		miRNA Info
miRNA Mature AC	MIMAT0004926
Sequence	aaggagcuuacaaucuagcuggg
miRNA Species	Homo sapiens
Regulation Mechanism	Overexpression of miR-708 reduced the expression of MMP2.		[28]
Evidence Score (E-score)	1		+
1	Western Blot		[28]
Representative Target(s) Regulated by This miRNA	Apoptosis inhibitor survivin (BIRC5)	Target Info	BIRC5_HUMAN
Representative Target(s) Regulated by This miRNA	Apoptosis regulator Bcl-2 (BCL-2)	Target Info	BCL2_HUMAN
miRNA Mature ID	hsa-miR-302a-5p		miRNA Info
miRNA Mature AC	MIMAT0000683
Sequence	acuuaaacguggauguacuugcu
miRNA Species	Homo sapiens
Regulation Mechanism	Overexpression of miR-942 resulted in the increased mRNA levels of MMP-2.		[29]
Evidence Score (E-score)	1		+
1	ELISA; Western Blot		[29]
Representative Target(s) Regulated by This miRNA	Matrix metalloproteinase-2 (MMP-2)	Target Info	MMP2_HUMAN
Representative Target(s) Regulated by This miRNA	Matrix metalloproteinase-9 (MMP-9)	Target Info	MMP9_HUMAN
miRNA Mature ID	hsa-miR-767-5p		miRNA Info
miRNA Mature AC	MIMAT0003882
Sequence	ugcaccaugguugucugagcaug
miRNA Species	Homo sapiens
Evidence Score (E-score)	1		+
1	Luciferase Reporter Assay		[2]
Representative Target(s) Regulated by This miRNA	Lysyl oxidase (LOX)	Target Info	LYOX_HUMAN
Representative Target(s) Regulated by This miRNA	Matrix metalloproteinase-2 (MMP-2)	Target Info	MMP2_HUMAN
References
REF 1	Different regulation of miR-29a-3p in glomeruli and tubules in an experimental model of angiotensin II-dependent hypertension: potential role in renal fibrosis. Clin Exp Pharmacol Physiol. 2016 Mar;43(3):335-42.
REF 2	A miRNA-regulatory network explains how dysregulated miRNAs perturb oncogenic processes across diverse cancers. Genome Res. 2012 Nov;22(11):2302-14.
REF 3	Characterization of microRNA-29 family expression and investigation of their mechanistic roles in gastric cancer. Carcinogenesis. 2014 Feb;35(2):497-506.
REF 4	MicroRNA-29a upregulates MMP2 in oral squamous cell carcinoma to promote cancer invasion and anti-apoptosis. Biomed Pharmacother. 2014 Feb;68(1):13-9.
REF 5	miRNA-29c suppresses lung cancer cell adhesion to extracellular matrix and metastasis by targeting integrin 1 and matrix metalloproteinase2 (MMP2). PLoS One. 2013 Aug 6;8(8):e70192.
REF 6	MicroRNA profiling of peripheral nerve sheath tumours identifies miR-29c as a tumour suppressor gene involved in tumour progression. Br J Cancer. 2013 Mar 5;108(4):964-72.
REF 7	MiR-130b suppresses prostate cancer metastasis through down-regulation of MMP2. Mol Carcinog. 2015 Nov;54(11):1292-300.
REF 8	MicroRNA-130b functions as an oncomiRNA in non-small cell lung cancer by targeting tissue inhibitor of metalloproteinase-2. Sci Rep. 2019 May 6;9(1):6956.
REF 9	miR-143 down-regulates TLR2 expression in hepatoma cells and inhibits hepatoma cell proliferation and invasion. Int J Clin Exp Pathol. 2015 Oct 1;8(10):12738-47.
REF 10	[miR-143 inhibits proliferation and invasion of hepatocellular carcinoma cells via down-regulation of TLR2 expression]. Xi Bao Yu Fen Zi Mian Yi Xue Za Zhi. 2014 Oct;30(10):1076-9.
REF 11	MicroRNA-203 Regulates Growth and Metastasis of Breast Cancer. Cell Physiol Biochem. 2015;37(1):35-42.
REF 12	MicroRNA-203 Modulates the Radiation Sensitivity of Human Malignant Glioma Cells. Int J Radiat Oncol Biol Phys. 2016 Feb 1;94(2):412-20.
REF 13	miR-221/222 induces pancreatic cancer progression through the regulation of matrix metalloproteinases. Oncotarget. 2015 Jun 10;6(16):14153-64.
REF 14	miR-29b, miR-205 and miR-221 enhance chemosensitivity to gemcitabine in HuH28 human cholangiocarcinoma cells. PLoS One. 2013 Oct 17;8(10):e77623.
REF 15	miR-338-3p suppresses invasion of liver cancer cell by targeting smoothened. J Pathol. 2011 Nov;225(3):463-72.
REF 16	MicroRNA-338-3p suppresses tumor growth of esophageal squamous cell carcinoma in vitro and in vivo. Mol Med Rep. 2015 Sep;12(3):3951-3957.
REF 17	Propofol inhibits proliferation and accelerates apoptosis of human gastric cancer cells by regulation of microRNA-451 and MMP-2 expression. Genet Mol Res. 2016 Apr 4;15(2).
REF 18	MiRNA-451 plays a role as tumor suppressor in human glioma cells. Brain Res. 2010 Nov 4;1359:14-21.
REF 19	Elevated microRNA-520g in pre-eclampsia inhibits migration and invasion of trophoblasts. Placenta. 2017 Mar;51:70-75.
REF 20	A microRNA-520 mirSNP at the MMP2 gene influences susceptibility to endometriosis in Chinese women. J Hum Genet. 2013 Apr;58(4):202-9.
REF 21	Downregulation of miR-106b induced breast cancer cell invasion and motility in association with overexpression of matrix metalloproteinase 2. Cancer Sci. 2014 Jan;105(1):18-25.
REF 22	miR-17-5p Promotes migration of human hepatocellular carcinoma cells through the p38 mitogen-activated protein kinase-heat shock protein 27 pathway. Hepatology. 2010 May;51(5):1614-23.
REF 23	MicroRNA-21 modulates biological functions of pancreatic cancer cells including their proliferation, invasion, and chemoresistance. Mol Cancer Ther. 2009 May;8(5):1067-74.
REF 24	Cigarette smoking decreases global microRNA expression in human alveolar macrophages. PLoS One. 2012;7(8):e44066.
REF 25	MicroRNA-491 is involved in metastasis of hepatocellular carcinoma by inhibitions of matrix metalloproteinase and epithelial to mesenchymal transition. Liver Int. 2013 Sep;33(8):1271-80.
REF 26	MiR-519d-3p suppresses invasion and migration of trophoblast cells via targeting MMP-2. PLoS One. 2015 Mar 24;10(3):e0120321.
REF 27	MicroRNA-524-5p suppresses the growth and invasive abilities of gastric cancer cells. Oncol Lett. 2016 Mar;11(3):1926-1932.
REF 28	miR-708 acts as a tumor suppressor in human glioblastoma cells. Oncol Rep. 2013 Aug;30(2):870-6.
REF 29	Up-regulation of microRNA-302a inhibited the proliferation and invasion of colorectal cancer cells by regulation of the MAPK and PI3K/Akt signaling... Int J Clin Exp Pathol. 2015 May 1;8(5):4481-91.

If You Find Any Error in Data or Bug in Web Service, Please Kindly Report It to Dr. Wang and Dr. Li.

Prof. Feng ZHU

Prof. Yuzong CHEN