Target Regulator(s) Information (MicroRNA)
Target General Information | |||||
---|---|---|---|---|---|
Target ID | T68251 | Target Info | |||
Target Name | Matrix metalloproteinase-2 (MMP-2) | ||||
Synonyms | TBE-1; Matrix metalloproteinase 2; CLG4A; 72 kDa type IV collagenase; 72 kDa gelatinase | ||||
Target Type | Successful Target | ||||
Gene Name | MMP2 | ||||
Biochemical Class | Peptidase | ||||
UniProt ID | |||||
The microRNAs (miRNAs) Regulating This Target | |||||
miRNA Mature ID | hsa-miR-29a-3p | miRNA Info | |||
miRNA Mature AC | |||||
Sequence | uagcaccaucugaaaucgguua | ||||
miRNA Species | Homo sapiens | ||||
Evidence Score (E-score) | 4 | + | |||
1 | Luciferase Reporter Assay | [1] | |||
2 | Luciferase Reporter Assay | [2] | |||
3 | Luciferase Reporter Assay; Northern Blot; qRT-PCR; Western Blot | [3] | |||
4 | Luciferase Reporter Assay; qRT-PCR; Western Blot | [4] | |||
Representative Target(s) Regulated by This miRNA | Apoptosis regulator Bcl-2 (BCL-2) | Target Info | |||
Aryl hydrocarbon receptor (AHR) | Target Info | ||||
miRNA Mature ID | hsa-miR-29c-3p | miRNA Info | |||
miRNA Mature AC | |||||
Sequence | uagcaccauuugaaaucgguua | ||||
miRNA Species | Homo sapiens | ||||
Evidence Score (E-score) | 4 | + | |||
1 | Luciferase Reporter Assay | [2] | |||
2 | Luciferase Reporter Assay; Northern Blot; qRT-PCR; Western Blot | [3] | |||
3 | Luciferase Reporter Assay; qRT-PCR; Western Blot | [5] | |||
4 | qRT-PCR; Western Blot | [6] | |||
Representative Target(s) Regulated by This miRNA | Apoptosis regulator Bcl-2 (BCL-2) | Target Info | |||
B7 homolog 3 (CD276) | Target Info | ||||
miRNA Mature ID | hsa-miR-130b-3p | miRNA Info | |||
miRNA Mature AC | |||||
Sequence | cagugcaaugaugaaagggcau | ||||
miRNA Species | Homo sapiens | ||||
Regulation Mechanism | miR-130b targets MMP2. The 3'UTR of MMP2 mRNA contains binding site for miR-130b. Dual-luciferase reporter assays showed that miR-130b significantly inhibited the activity of firefly luciferase that carried WT but not mutant 30-UTR of MMP2. | [7] | |||
Evidence Score (E-score) | 2 | + | |||
1 | Luciferase Reporter Assay; Western Blot | [7] | |||
2 | Western Blot; Immunofluorescent Staining | [8] | |||
Representative Target(s) Regulated by This miRNA | Acyl-CoA desaturase (SCD) | Target Info | |||
Cyclin A2 (CCNA2) | Target Info | ||||
miRNA Mature ID | hsa-miR-143-3p | miRNA Info | |||
miRNA Mature AC | |||||
Sequence | ugagaugaagcacuguagcuc | ||||
miRNA Species | Homo sapiens | ||||
Regulation Mechanism | Intervention with miR-143mimic, the mRNA and protein expression levels of MMP-2 was decreased significantly. | [9] | |||
Evidence Score (E-score) | 2 | + | |||
1 | qRT-PCR; Western Blot | [9] | |||
2 | RT-PCR | [10] | |||
Representative Target(s) Regulated by This miRNA | Apoptosis regulator Bcl-2 (BCL-2) | Target Info | |||
Connective tissue growth factor (CTGF) | Target Info | ||||
miRNA Mature ID | hsa-miR-203a-5p | miRNA Info | |||
miRNA Mature AC | |||||
Sequence | agugguucuuaacaguucaacaguu | ||||
miRNA Species | Homo sapiens | ||||
Evidence Score (E-score) | 2 | + | |||
1 | Western Blot | [11] | |||
2 | Western Blot | [12] | |||
Representative Target(s) Regulated by This miRNA | CDK inhibitor 1B p27Kip1 (CDKN1B) | Target Info | |||
Cyclin-dependent kinase 6 (CDK6) | Target Info | ||||
miRNA Mature ID | hsa-miR-221-3p | miRNA Info | |||
miRNA Mature AC | |||||
Sequence | agcuacauugucugcuggguuuc | ||||
miRNA Species | Homo sapiens | ||||
Regulation Mechanism | miR-221 restored Gem sensitivity to HuH28 cells by suppressing MMP-2. | [14] | |||
Evidence Score (E-score) | 2 | + | |||
1 | Dual Luciferase Reporter Assay; Western Blot; RT-PCR | [13] | |||
2 | Western Blot | [14] | |||
Representative Target(s) Regulated by This miRNA | Bcl-2-binding component 3 (BBC3) | Target Info | |||
Beclin-1 (BECN1) | Target Info | ||||
miRNA Mature ID | hsa-miR-338-3p | miRNA Info | |||
miRNA Mature AC | |||||
Sequence | uccagcaucagugauuuuguug | ||||
miRNA Species | Homo sapiens | ||||
Evidence Score (E-score) | 2 | + | |||
1 | Western Blot; qRT-PCR | [15] | |||
2 | Western Blot; RT-PCR | [16] | |||
Representative Target(s) Regulated by This miRNA | G1/S-specific cyclin-D1 (CCND1) | Target Info | |||
Hypoxia-inducible factor 1 alpha (HIF-1A) | Target Info | ||||
miRNA Mature ID | hsa-miR-451a | miRNA Info | |||
miRNA Mature AC | |||||
Sequence | aaaccguuaccauuacugaguu | ||||
miRNA Species | Homo sapiens | ||||
Evidence Score (E-score) | 2 | + | |||
1 | qRT-PCR; Western Blot | [17] | |||
2 | qRT-PCR; Western Blot | [18] | |||
Representative Target(s) Regulated by This miRNA | Apoptosis regulator Bcl-2 (BCL-2) | Target Info | |||
Extracellular signal-regulated kinase 2 (ERK2) | Target Info | ||||
miRNA Mature ID | hsa-miR-520g-3p | miRNA Info | |||
miRNA Mature AC | |||||
Sequence | acaaagugcuucccuuuagagugu | ||||
miRNA Species | Homo sapiens | ||||
Regulation Mechanism | miR-520g mimic reduced the relative luciferase activity of the wide type MMP2 vector but not of the mutated MMP2 vector. | [19] | |||
Evidence Score (E-score) | 2 | + | |||
1 | In Situ Hybridization; Luciferase Reporter Assay; Western Blot | [19] | |||
2 | Reporter Assay | [20] | |||
Representative Target(s) Regulated by This miRNA | Matrix metalloproteinase-2 (MMP-2) | Target Info | |||
Vascular endothelial growth factor A (VEGFA) | Target Info | ||||
miRNA Mature ID | hsa-miR-106b-5p | miRNA Info | |||
miRNA Mature AC | |||||
Sequence | uaaagugcugacagugcagau | ||||
miRNA Species | Homo sapiens | ||||
Regulation Mechanism | Matrix metalloproteinase 2 (MMP2) is the direct target of miR-106b. | [21] | |||
Evidence Score (E-score) | 1 | + | |||
1 | Luciferase Reporter Assay | [21] | |||
Representative Target(s) Regulated by This miRNA | Amyloid beta A4 protein (APP) | Target Info | |||
Apoptosis mediating surface antigen FAS (FAS) | Target Info | ||||
miRNA Mature ID | hsa-miR-17-5p | miRNA Info | |||
miRNA Mature AC | |||||
Sequence | caaagugcuuacagugcagguag | ||||
miRNA Species | Homo sapiens | ||||
Evidence Score (E-score) | 1 | + | |||
1 | Western Blot | [22] | |||
Representative Target(s) Regulated by This miRNA | Amyloid beta A4 protein (APP) | Target Info | |||
Apoptosis mediating surface antigen FAS (FAS) | Target Info | ||||
miRNA Mature ID | hsa-miR-21-5p | miRNA Info | |||
miRNA Mature AC | |||||
Sequence | uagcuuaucagacugauguuga | ||||
miRNA Species | Homo sapiens | ||||
Evidence Score (E-score) | 1 | + | |||
1 | qRT-PCR | [23] | |||
Representative Target(s) Regulated by This miRNA | Apoptosis antigen ligand (CD178) | Target Info | |||
Apoptosis regulator Bcl-2 (BCL-2) | Target Info | ||||
miRNA Mature ID | hsa-miR-452-5p | miRNA Info | |||
miRNA Mature AC | |||||
Sequence | aacuguuugcagaggaaacuga | ||||
miRNA Species | Homo sapiens | ||||
Evidence Score (E-score) | 1 | + | |||
1 | Microarray | [24] | |||
Representative Target(s) Regulated by This miRNA | CDK inhibitor 1B p27Kip1 (CDKN1B) | Target Info | |||
Dihydropyrimidinase related protein 2 (DPYSL2) | Target Info | ||||
miRNA Mature ID | hsa-miR-491-5p | miRNA Info | |||
miRNA Mature AC | |||||
Sequence | aguggggaacccuuccaugagg | ||||
miRNA Species | Homo sapiens | ||||
Regulation Mechanism | miR-491 is involved in the expressions of MMP2 in hepatocellular carcinoma (HCC) cell lines. | [25] | |||
Evidence Score (E-score) | 1 | + | |||
1 | Immunohistochemistry; Western Blot | [25] | |||
Representative Target(s) Regulated by This miRNA | Apoptosis regulator Bcl-xL (BCL-xL) | Target Info | |||
Cellular tumor antigen p53 (TP53) | Target Info | ||||
miRNA Mature ID | hsa-miR-519d-3p | miRNA Info | |||
miRNA Mature AC | |||||
Sequence | caaagugccucccuuuagagug | ||||
miRNA Species | Homo sapiens | ||||
Regulation Mechanism | MMP-2 is a direct target of miR-519d-3p. | [26] | |||
Evidence Score (E-score) | 1 | + | |||
1 | Luciferase Reporter Assay | [26] | |||
Representative Target(s) Regulated by This miRNA | Calcium-release activated calcium channel (CRACM) | Target Info | |||
E2F transcription factor 1 (E2F1) | Target Info | ||||
miRNA Mature ID | hsa-miR-524-5p | miRNA Info | |||
miRNA Mature AC | |||||
Sequence | cuacaaagggaagcacuuucuc | ||||
miRNA Species | Homo sapiens | ||||
Evidence Score (E-score) | 1 | + | |||
1 | qRT-PCR; Western Blot | [27] | |||
Representative Target(s) Regulated by This miRNA | Cyclin-dependent kinase 2 (CDK2) | Target Info | |||
Dual specificity protein kinase TTK (MPS1) | Target Info | ||||
miRNA Mature ID | hsa-miR-708-5p | miRNA Info | |||
miRNA Mature AC | |||||
Sequence | aaggagcuuacaaucuagcuggg | ||||
miRNA Species | Homo sapiens | ||||
Regulation Mechanism | Overexpression of miR-708 reduced the expression of MMP2. | [28] | |||
Evidence Score (E-score) | 1 | + | |||
1 | Western Blot | [28] | |||
Representative Target(s) Regulated by This miRNA | Apoptosis inhibitor survivin (BIRC5) | Target Info | |||
Apoptosis regulator Bcl-2 (BCL-2) | Target Info | ||||
miRNA Mature ID | hsa-miR-302a-5p | miRNA Info | |||
miRNA Mature AC | |||||
Sequence | acuuaaacguggauguacuugcu | ||||
miRNA Species | Homo sapiens | ||||
Regulation Mechanism | Overexpression of miR-942 resulted in the increased mRNA levels of MMP-2. | [29] | |||
Evidence Score (E-score) | 1 | + | |||
1 | ELISA; Western Blot | [29] | |||
Representative Target(s) Regulated by This miRNA | Matrix metalloproteinase-2 (MMP-2) | Target Info | |||
Matrix metalloproteinase-9 (MMP-9) | Target Info | ||||
miRNA Mature ID | hsa-miR-767-5p | miRNA Info | |||
miRNA Mature AC | |||||
Sequence | ugcaccaugguugucugagcaug | ||||
miRNA Species | Homo sapiens | ||||
Evidence Score (E-score) | 1 | + | |||
1 | Luciferase Reporter Assay | [2] | |||
Representative Target(s) Regulated by This miRNA | Lysyl oxidase (LOX) | Target Info | |||
Matrix metalloproteinase-2 (MMP-2) | Target Info | ||||
References | |||||
REF 1 | Different regulation of miR-29a-3p in glomeruli and tubules in an experimental model of angiotensin II-dependent hypertension: potential role in renal fibrosis. Clin Exp Pharmacol Physiol. 2016 Mar;43(3):335-42. | ||||
REF 2 | A miRNA-regulatory network explains how dysregulated miRNAs perturb oncogenic processes across diverse cancers. Genome Res. 2012 Nov;22(11):2302-14. | ||||
REF 3 | Characterization of microRNA-29 family expression and investigation of their mechanistic roles in gastric cancer. Carcinogenesis. 2014 Feb;35(2):497-506. | ||||
REF 4 | MicroRNA-29a upregulates MMP2 in oral squamous cell carcinoma to promote cancer invasion and anti-apoptosis. Biomed Pharmacother. 2014 Feb;68(1):13-9. | ||||
REF 5 | miRNA-29c suppresses lung cancer cell adhesion to extracellular matrix and metastasis by targeting integrin 1 and matrix metalloproteinase2 (MMP2). PLoS One. 2013 Aug 6;8(8):e70192. | ||||
REF 6 | MicroRNA profiling of peripheral nerve sheath tumours identifies miR-29c as a tumour suppressor gene involved in tumour progression. Br J Cancer. 2013 Mar 5;108(4):964-72. | ||||
REF 7 | MiR-130b suppresses prostate cancer metastasis through down-regulation of MMP2. Mol Carcinog. 2015 Nov;54(11):1292-300. | ||||
REF 8 | MicroRNA-130b functions as an oncomiRNA in non-small cell lung cancer by targeting tissue inhibitor of metalloproteinase-2. Sci Rep. 2019 May 6;9(1):6956. | ||||
REF 9 | miR-143 down-regulates TLR2 expression in hepatoma cells and inhibits hepatoma cell proliferation and invasion. Int J Clin Exp Pathol. 2015 Oct 1;8(10):12738-47. | ||||
REF 10 | [miR-143 inhibits proliferation and invasion of hepatocellular carcinoma cells via down-regulation of TLR2 expression]. Xi Bao Yu Fen Zi Mian Yi Xue Za Zhi. 2014 Oct;30(10):1076-9. | ||||
REF 11 | MicroRNA-203 Regulates Growth and Metastasis of Breast Cancer. Cell Physiol Biochem. 2015;37(1):35-42. | ||||
REF 12 | MicroRNA-203 Modulates the Radiation Sensitivity of Human Malignant Glioma Cells. Int J Radiat Oncol Biol Phys. 2016 Feb 1;94(2):412-20. | ||||
REF 13 | miR-221/222 induces pancreatic cancer progression through the regulation of matrix metalloproteinases. Oncotarget. 2015 Jun 10;6(16):14153-64. | ||||
REF 14 | miR-29b, miR-205 and miR-221 enhance chemosensitivity to gemcitabine in HuH28 human cholangiocarcinoma cells. PLoS One. 2013 Oct 17;8(10):e77623. | ||||
REF 15 | miR-338-3p suppresses invasion of liver cancer cell by targeting smoothened. J Pathol. 2011 Nov;225(3):463-72. | ||||
REF 16 | MicroRNA-338-3p suppresses tumor growth of esophageal squamous cell carcinoma in vitro and in vivo. Mol Med Rep. 2015 Sep;12(3):3951-3957. | ||||
REF 17 | Propofol inhibits proliferation and accelerates apoptosis of human gastric cancer cells by regulation of microRNA-451 and MMP-2 expression. Genet Mol Res. 2016 Apr 4;15(2). | ||||
REF 18 | MiRNA-451 plays a role as tumor suppressor in human glioma cells. Brain Res. 2010 Nov 4;1359:14-21. | ||||
REF 19 | Elevated microRNA-520g in pre-eclampsia inhibits migration and invasion of trophoblasts. Placenta. 2017 Mar;51:70-75. | ||||
REF 20 | A microRNA-520 mirSNP at the MMP2 gene influences susceptibility to endometriosis in Chinese women. J Hum Genet. 2013 Apr;58(4):202-9. | ||||
REF 21 | Downregulation of miR-106b induced breast cancer cell invasion and motility in association with overexpression of matrix metalloproteinase 2. Cancer Sci. 2014 Jan;105(1):18-25. | ||||
REF 22 | miR-17-5p Promotes migration of human hepatocellular carcinoma cells through the p38 mitogen-activated protein kinase-heat shock protein 27 pathway. Hepatology. 2010 May;51(5):1614-23. | ||||
REF 23 | MicroRNA-21 modulates biological functions of pancreatic cancer cells including their proliferation, invasion, and chemoresistance. Mol Cancer Ther. 2009 May;8(5):1067-74. | ||||
REF 24 | Cigarette smoking decreases global microRNA expression in human alveolar macrophages. PLoS One. 2012;7(8):e44066. | ||||
REF 25 | MicroRNA-491 is involved in metastasis of hepatocellular carcinoma by inhibitions of matrix metalloproteinase and epithelial to mesenchymal transition. Liver Int. 2013 Sep;33(8):1271-80. | ||||
REF 26 | MiR-519d-3p suppresses invasion and migration of trophoblast cells via targeting MMP-2. PLoS One. 2015 Mar 24;10(3):e0120321. | ||||
REF 27 | MicroRNA-524-5p suppresses the growth and invasive abilities of gastric cancer cells. Oncol Lett. 2016 Mar;11(3):1926-1932. | ||||
REF 28 | miR-708 acts as a tumor suppressor in human glioblastoma cells. Oncol Rep. 2013 Aug;30(2):870-6. | ||||
REF 29 | Up-regulation of microRNA-302a inhibited the proliferation and invasion of colorectal cancer cells by regulation of the MAPK and PI3K/Akt signaling... Int J Clin Exp Pathol. 2015 May 1;8(5):4481-91. |
If You Find Any Error in Data or Bug in Web Service, Please Kindly Report It to Dr. Wang and Dr. Li.