Target Regulator(s) Information (MicroRNA)

Content Navigation (  All   None )                                      
Target General Information
The microRNAs (miRNAs) Regulating This Target
References
Target General Information  Top
Target ID T38453 Target Info
Target Name Zinc finger E-box-binding homeobox 2 (ZEB2)
Synonyms Zinc finger homeobox protein 1b; ZFX1B; ZFHX1B; Smad-interacting protein 1; SMADIP1; SIP1; KIAA0569; HRIHFB2411
Target Type Literature-reported Target
Gene Name ZEB2
UniProt ID
O60315
The microRNAs (miRNAs) Regulating This Target  Top
miRNA Mature ID hsa-miR-200a-3p miRNA Info
miRNA Mature AC
MIMAT0000682
Sequence uaacacugucugguaacgaugu
miRNA Species Homo sapiens
Regulation Mechanism The overexpression of miR-200a-3p resulted in the changed mRNA level of target ZEB2. [8]
Evidence Score (E-score) 17 +
1 Immunoblot; In Situ Hybridization; Microarray [1]
2 Immunofluorescence; Immunohistochemistry; In Situ Hybridization; qRT-PCR; Western Blot [2]
3 Immunofluorescence; Microarray; qRT-PCR; Western Blot [3]
4 Immunohistochemistry; Luciferase Reporter Assay; Microarray; qRT-PCR; Western Blot [4]
5 Immunohistochemistry; Luciferase Reporter Assay; qRT-PCR; Western Blot [5]
6 Immunohistochemistry; qRT-PCR [6]
7 Luciferase Reporter Assay [7]
8 Luciferase Reporter Assay; Microarray; Western Blot [8]
9 Luciferase Reporter Assay; qRT-PCR [9]
10 Luciferase Reporter Assay; qRT-PCR [10]
11 Luciferase Reporter Assay; qRT-PCR; Western Blot [11]
12 Luciferase Reporter Assay; qRT-PCR; Western Blot [12]
13 Luciferase Reporter Assay; qRT-PCR; Western Blot [13]
14 qRT-PCR; Luciferase Reporter Assay; Western Blot [14]
15 qRT-PCR; Western Blot [15]
16 qRT-PCR; Western Blot [16]
17 qRT-PCR; Western Blot [17]
Representative Target(s) Regulated by This miRNA Amphiregulin (AREG) Target Info
AREG_HUMAN
Beta-catenin (CTNNB1) Target Info
CTNB1_HUMAN
miRNA Mature ID hsa-miR-200b-3p miRNA Info
miRNA Mature AC
MIMAT0000318
Sequence uaauacugccugguaaugauga
miRNA Species Homo sapiens
Regulation Mechanism The overexpression of miR-200b-3p resulted in the changed mRNA level of target ZEB2. [8]
Evidence Score (E-score) 16 +
1 Immunohistochemistry; Luciferase Reporter Assay; Microarray; qRT-PCR; Western Blot [18]
2 Immunohistochemistry; Luciferase Reporter Assay; Microarray; Western Blot [19]
3 Immunohistochemistry; Microarray; qRT-PCR; Western Blot [20]
4 Immunohistochemistry; qRT-PCR [6]
5 In Situ Hybridization; qRT-PCR; Western Blot [3]
6 Luciferase Reporter Assay [21]
7 Luciferase Reporter Assay [22]
8 Luciferase Reporter Assay [7]
9 Luciferase Reporter Assay; Microarray; Western Blot [8]
10 Luciferase Reporter Assay; qRT-PCR [9]
11 Luciferase Reporter Assay; qRT-PCR [10]
12 Luciferase Reporter Assay; qRT-PCR; Western Blot [23]
13 Luciferase Reporter Assay; qRT-PCR; Western Blot [24]
14 Luciferase Reporter Assay; qRT-PCR; Western Blot [12]
15 qRT-PCR; Western Blot [16]
16 Western Blot [25]
Representative Target(s) Regulated by This miRNA Apoptosis regulator Bcl-2 (BCL-2) Target Info
BCL2_HUMAN
CDK inhibitor 1B p27Kip1 (CDKN1B) Target Info
CDN1B_HUMAN
miRNA Mature ID hsa-miR-200c-3p miRNA Info
miRNA Mature AC
MIMAT0000617
Sequence uaauacugccggguaaugaugga
miRNA Species Homo sapiens
Regulation Mechanism miR-200 was found to directly target the mRNA of the E-cadherin transcriptional repressors ZEB1 (TCF8/ EF1) and ZEB2 (SMAD-interacting protein 1 [SIP1]/ZFXH1B). [8]
Evidence Score (E-score) 14 +
1 Immunoblot; Luciferase Reporter Assay; qRT-PCR [26]
2 Immunohistochemistry; qRT-PCR [6]
3 Luciferase Reporter Assay [27]
4 Luciferase Reporter Assay [9]
5 Luciferase Reporter Assay [22]
6 Luciferase Reporter Assay; qRT-PCR [10]
7 Luciferase Reporter Assay; qRT-PCR; Western Blot [28]
8 Luciferase Reporter Assay; qRT-PCR; Western Blot [12]
9 Luciferase Reporter Assay; Western Blot [29]
10 Luciferase Reporter Assay; Western Blot [8]
11 qRT-PCR; Luciferase Reporter Assay; Western Blot [14]
12 qRT-PCR; Western Blot [15]
13 qRT-PCR; Western Blot [30]
14 qRT-PCR; Western Blot [16]
Representative Target(s) Regulated by This miRNA Activin receptor type IIB (ACVR2B) Target Info
AVR2B_HUMAN
Apoptosis regulator Bcl-2 (BCL-2) Target Info
BCL2_HUMAN
miRNA Mature ID hsa-miR-141-3p miRNA Info
miRNA Mature AC
MIMAT0000432
Sequence uaacacugucugguaaagaugg
miRNA Species Homo sapiens
Regulation Mechanism Co-transfection of the reporter plasmid along with miR-141 in 4TO7 cells resulted in a significantly reduced ZEB2-3'UTR-luciferase expression, suggesting that these miRNAs are likely to target ZEB2 directly. [10]
Evidence Score (E-score) 6 +
1 Luciferase Reporter Assay [31]
2 Luciferase Reporter Assay [9]
3 Luciferase Reporter Assay [10]
4 Luciferase Reporter Assay; qRT-PCR; Western Blot [32]
5 Luciferase Reporter Assay; qRT-PCR; Western Blot [28]
6 Luciferase Reporter Assay; qRT-PCR; Western Blot [33]
Representative Target(s) Regulated by This miRNA Activin receptor type IIB (ACVR2B) Target Info
AVR2B_HUMAN
Bromodomain-containing protein 3 (BRD3) Target Info
BRD3_HUMAN
miRNA Mature ID hsa-miR-429 miRNA Info
miRNA Mature AC
MIMAT0001536
Sequence uaauacugucugguaaaaccgu
miRNA Species Homo sapiens
Regulation Mechanism Co-transfection of the reporter plasmid along with miR-429 in 4TO7 cells resulted in a significantly reduced ZEB2-3'UTR-luciferase expression, suggesting that these miRNAs are likely to target ZEB2 directly. [10]
Evidence Score (E-score) 4 +
1 Luciferase Reporter Assay [9]
2 Luciferase Reporter Assay [7]
3 Luciferase Reporter Assay [10]
4 Luciferase Reporter Assay; qRT-PCR; Western Blot [34]
Representative Target(s) Regulated by This miRNA Apoptosis regulator Bcl-2 (BCL-2) Target Info
BCL2_HUMAN
DNA [cytosine-5]-methyltransferase 1 (DNMT1) Target Info
DNMT1_HUMAN
miRNA Mature ID hsa-miR-205-5p miRNA Info
miRNA Mature AC
MIMAT0000266
Sequence uccuucauuccaccggagucug
miRNA Species Homo sapiens
Regulation Mechanism The overexpression of miR-205-5p by mature miRNA precursor transfection resulted in the changed mRNA level of target ZEB2. [8]
Evidence Score (E-score) 2 +
1 ChIP; Reporter Assay [8]
2 Immunoblot; qRT-PCR [35]
Representative Target(s) Regulated by This miRNA Androgen receptor (AR) Target Info
ANDR_HUMAN
Apoptosis regulator Bcl-2 (BCL-2) Target Info
BCL2_HUMAN
miRNA Mature ID hsa-miR-708-5p miRNA Info
miRNA Mature AC
MIMAT0004926
Sequence aaggagcuuacaaucuagcuggg
miRNA Species Homo sapiens
Evidence Score (E-score) 2 +
1 Luciferase Reporter Assay; Microarray; qRT-PCR; Western Blot [36]
2 Luciferase Reporter Assay; Microarray; qRT-PCR; Western Blot [8]
Representative Target(s) Regulated by This miRNA Apoptosis inhibitor survivin (BIRC5) Target Info
BIRC5_HUMAN
Apoptosis regulator Bcl-2 (BCL-2) Target Info
BCL2_HUMAN
miRNA Mature ID hsa-miR-144-3p miRNA Info
miRNA Mature AC
MIMAT0000436
Sequence uacaguauagaugauguacu
miRNA Species Homo sapiens
Regulation Mechanism miR-144 can directly target at 3'untranslation region of ZEB2, and regulate its expression at transcriptional and translational levels. [37]
Evidence Score (E-score) 1 +
1 Luciferase Reporter Assay; Western Blot [37]
Representative Target(s) Regulated by This miRNA ADAM metallopeptidase with thrombospondin 1 (ADAMTS1) Target Info
ATS1_HUMAN
Amyloid beta A4 protein (APP) Target Info
A4_HUMAN
miRNA Mature ID hsa-miR-203a-3p miRNA Info
miRNA Mature AC
MIMAT0000264
Sequence gugaaauguuuaggaccacuag
miRNA Species Homo sapiens
Evidence Score (E-score) 1 +
1 Immunoblot; In Situ Hybridization; Luciferase Reporter Assay; Western Blot [38]
Representative Target(s) Regulated by This miRNA Apoptosis inhibitor survivin (BIRC5) Target Info
BIRC5_HUMAN
Apoptosis regulator Bcl-W (BCL-W) Target Info
B2CL2_HUMAN
miRNA Mature ID hsa-miR-215-5p miRNA Info
miRNA Mature AC
MIMAT0000272
Sequence augaccuaugaauugacagac
miRNA Species Homo sapiens
Evidence Score (E-score) 1 +
1 Western Blot [39]
Representative Target(s) Regulated by This miRNA Activated leukocyte cell adhesionmolecule (ALCAM) Target Info
CD166_HUMAN
Activin receptor type IIB (ACVR2B) Target Info
AVR2B_HUMAN
miRNA Mature ID hsa-miR-221-3p miRNA Info
miRNA Mature AC
MIMAT0000278
Sequence agcuacauugucugcuggguuuc
miRNA Species Homo sapiens
Evidence Score (E-score) 1 +
1 Reporter Assay; Western Blot [40]
Representative Target(s) Regulated by This miRNA Bcl-2-binding component 3 (BBC3) Target Info
BBC3_HUMAN
Beclin-1 (BECN1) Target Info
BECN1_HUMAN
miRNA Mature ID hsa-miR-335-5p miRNA Info
miRNA Mature AC
MIMAT0000765
Sequence ucaagagcaauaacgaaaaaugu
miRNA Species Homo sapiens
Evidence Score (E-score) 1 +
1 Luciferase Reporter Assay; Western Blot [41]
Representative Target(s) Regulated by This miRNA Apoptosis inhibitor survivin (BIRC5) Target Info
BIRC5_HUMAN
Apoptosis regulator Bcl-W (BCL-W) Target Info
B2CL2_HUMAN
miRNA Mature ID hsa-miR-338-3p miRNA Info
miRNA Mature AC
MIMAT0000763
Sequence uccagcaucagugauuuuguug
miRNA Species Homo sapiens
Regulation Mechanism miR-338-3p inhibited the EMT progression in gastric cancer cells by targeting ZEb2. [42]
Evidence Score (E-score) 1 +
1 Luciferase Reporter Assay; Western Blot [42]
Representative Target(s) Regulated by This miRNA G1/S-specific cyclin-D1 (CCND1) Target Info
CCND1_HUMAN
Hypoxia-inducible factor 1 alpha (HIF-1A) Target Info
HIF1A_HUMAN
miRNA Mature ID hsa-miR-138-1-3p miRNA Info
miRNA Mature AC
MIMAT0004607
Sequence gcuacuucacaacaccagggcc
miRNA Species Homo sapiens
Regulation Mechanism Suppression of miR-138 in BC cells promotes ZEB2-mediated cancer invasion and metastases. [43]
Evidence Score (E-score) 1 +
1 Luciferase Reporter Assay; Western Blot [43]
Representative Target(s) Regulated by This miRNA Hypoxia-inducible factor 1 alpha (HIF-1A) Target Info
HIF1A_HUMAN
Pyruvate dehydrogenase kinase 1 (PDHK1) Target Info
PDK1_HUMAN
miRNA Mature ID hsa-miR-154-5p miRNA Info
miRNA Mature AC
MIMAT0000452
Sequence uagguuauccguguugccuucg
miRNA Species Homo sapiens
Regulation Mechanism miR-154 was able to target the 3'-untranslated region (3'UTR) of ZEB2 mRNA. [44]
Evidence Score (E-score) 1 +
1 Luciferase Reporter Assay; Western Blot [44]
Representative Target(s) Regulated by This miRNA High mobility group protein HMGI-C (HMGA2) Target Info
HMGA2_HUMAN
Toll-like receptor 2 (TLR2) Target Info
TLR2_HUMAN
miRNA Mature ID hsa-miR-4782-3p miRNA Info
miRNA Mature AC
MIMAT0019945
Sequence ugauugucuucauaucuagaac
miRNA Species Homo sapiens
Regulation Mechanism miR-4782-3p inhibited cell proliferation in NSCLC by targeting ZEB2. [45]
Evidence Score (E-score) 1 +
1 Luciferase Reporter Assay; Western Blot [45]
Representative Target(s) Regulated by This miRNA Ubiquitin carboxyl-terminal hydrolase 14 (USP14) Target Info
UBP14_HUMAN
X-linked inhibitor of apoptosis protein (XIAP) Target Info
XIAP_HUMAN
miRNA Mature ID hsa-miR-590-3p miRNA Info
miRNA Mature AC
MIMAT0004801
Sequence uaauuuuauguauaagcuagu
miRNA Species Homo sapiens
Regulation Mechanism miR-590-3p negatively regulates ZEB2 expression by directly targeting their 3'UTR regions. [46]
Evidence Score (E-score) 1 +
1 Luciferase Reporter Assay; Western Blot [46]
Representative Target(s) Regulated by This miRNA Fos-related antigen 2 (FOSL2) Target Info
FOSL2_HUMAN
Zinc finger E-box-binding homeobox 2 (ZEB2) Target Info
ZEB2_HUMAN
References  Top
REF 1 Loss of microRNA-200a expression correlates with tumor progression in breast cancer. Transl Res. 2014 Mar;163(3):242-51.
REF 2 Downregulated microRNA-200a promotes EMT and tumor growth through the wnt/-catenin pathway by targeting the E-cadherin repressors ZEB1/ZEB2 in gastric adenocarcinoma. Oncol Rep. 2013 Apr;29(4):1579-87.
REF 3 The miR-200 family regulates TGF-1-induced renal tubular epithelial to mesenchymal transition through Smad pathway by targeting ZEB1 and ZEB2 expression. Am J Physiol Renal Physiol. 2012 Feb 1;302(3):F369-79.
REF 4 1 integrin inhibition elicits a prometastatic switch through the TGF-miR-200-ZEB network in E-cadherin-positive triple-negative breast cancer. Sci Signal. 2014 Feb 11;7(312):ra15.
REF 5 Critical regulation of miR-200/ZEB2 pathway in Oct4/Sox2-induced mesenchymal-to-epithelial transition and induced pluripotent stem cell generation. Proc Natl Acad Sci U S A. 2013 Feb 19;110(8):2858-63.
REF 6 Micro-RNA signature of the epithelial-mesenchymal transition in endometrial carcinosarcoma. J Pathol. 2011 Jan;223(1):72-80.
REF 7 A double-negative feedback loop between ZEB1-SIP1 and the microRNA-200 family regulates epithelial-mesenchymal transition. Cancer Res. 2008 Oct 1;68(19):7846-54.
REF 8 The miR-200 family and miR-205 regulate epithelial to mesenchymal transition by targeting ZEB1 and SIP1. Nat Cell Biol. 2008 May;10(5):593-601.
REF 9 Regulation of miR-200 family microRNAs and ZEB transcription factors in ovarian cancer: evidence supporting a mesothelial-to-epithelial transition. Gynecol Oncol. 2010 Jan;116(1):117-25.
REF 10 The miR-200 family inhibits epithelial-mesenchymal transition and cancer cell migration by direct targeting of E-cadherin transcriptional repressors ZEB1 and ZEB2. J Biol Chem. 2008 May 30;283(22):14910-4.
REF 11 MicroRNA-200a inhibits CD133/1+ ovarian cancer stem cells migration and invasion by targeting E-cadherin repressor ZEB2. Gynecol Oncol. 2011 Jul;122(1):149-54.
REF 12 miR-200b precursor can ameliorate renal tubulointerstitial fibrosis. PLoS One. 2010 Oct 25;5(10):e13614.
REF 13 miR-200a-mediated downregulation of ZEB2 and CTNNB1 differentially inhibits nasopharyngeal carcinoma cell growth, migration and invasion. Biochem Biophys Res Commun. 2010 Jan 1;391(1):535-41.
REF 14 The miR-200 family determines the epithelial phenotype of cancer cells by targeting the E-cadherin repressors ZEB1 and ZEB2. Genes Dev. 2008 Apr 1;22(7):894-907.
REF 15 A miRNA signature associated with human metastatic medullary thyroid carcinoma. Endocr Relat Cancer. 2013 Oct 14;20(6):809-23.
REF 16 Phosphoglucose isomerase/autocrine motility factor mediates epithelial-mesenchymal transition regulated by miR-200 in breast cancer cells. Cancer Res. 2011 May 1;71(9):3400-9.
REF 17 Downregulated microRNA-200a in meningiomas promotes tumor growth by reducing E-cadherin and activating the Wnt/beta-catenin signaling pathway. Mol Cell Biol. 2009 Nov;29(21):5923-40.
REF 18 Zinc finger E-box-binding homeobox 2 (ZEB2) regulated by miR-200b contributes to multi-drug resistance of small cell lung cancer. Exp Mol Pathol. 2014 Jun;96(3):438-44.
REF 19 MicroRNA-200 family members and ZEB2 are associated with brain metastasis in gastric adenocarcinoma. Int J Oncol. 2014 Dec;45(6):2403-10.
REF 20 Epigenetic modulation and repression of miR-200b by cancer-associated fibroblasts contribute to cancer invasion and peritoneal dissemination in gastric cancer. Carcinogenesis. 2015 Jan;36(1):133-41.
REF 21 MicroRNA-200b regulates cell proliferation, invasion, and migration by directly targeting ZEB2 in gastric carcinoma. Ann Surg Oncol. 2012 Jul;19 Suppl 3:S656-64.
REF 22 E-cadherin transcriptional down-regulation by epigenetic and microRNA-200 family alterations is related to mesenchymal and drug-resistant phenotypes in human breast cancer cells. Int J Cancer. 2010 Jun 1;126(11):2575-83.
REF 23 MicroRNA-200b inhibits the growth and metastasis of glioma cells via targeting ZEB2. Int J Oncol. 2016 Feb;48(2):541-50.
REF 24 MiRNA-200b represses transforming growth factor-1-induced EMT and fibronectin expression in kidney proximal tubular cells. Am J Physiol Renal Physiol. 2013 May 15;304(10):F1266-73.
REF 25 Differential expression of microRNAs in retinal vasculopathy caused by selective Mler cell disruption. Sci Rep. 2016 Jul 4;6:28993.
REF 26 MicroRNA-200c attenuates tumour growth and metastasis of presumptive head and neck squamous cell carcinoma stem cells. J Pathol. 2011 Mar;223(4):482-95.
REF 27 miR-200c regulates induction of apoptosis through CD95 by targeting FAP-1. Mol Cell. 2010 Jun 25;38(6):908-15.
REF 28 The downregulation of miR-200c/141 promotes ZEB1/2 expression and gastric cancer progression. Med Oncol. 2015 Jan;32(1):428.
REF 29 Endometrial miR-200c is altered during transformation into cancerous states and targets the expression of ZEBs, VEGFA, FLT1, IKK, KLF9, and FBLN5. Reprod Sci. 2012 Aug;19(8):786-96.
REF 30 Dynamic epigenetic regulation of the microRNA-200 family mediates epithelial and mesenchymal transitions in human tumorigenesis. Oncogene. 2012 Apr 19;31(16):2062-74.
REF 31 A useful method of identifying of miRNAs which can down-regulate Zeb-2. BMC Res Notes. 2013 Nov 18;6:470.
REF 32 MicroRNA-141 inhibits migration of gastric cancer by targeting zinc finger E-box-binding homeobox 2. Mol Med Rep. 2015 Sep;12(3):3416-3422.
REF 33 MicroRNA-141 regulates Smad interacting protein 1 (SIP1) and inhibits migration and invasion of colorectal cancer cells. Dig Dis Sci. 2010 Aug;55(8):2365-72.
REF 34 MiR-429 regulates gastric cancer cell invasiveness through ZEB proteins. Tumour Biol. 2015 Oct 15. [Epub ahead of print] Retracted Publication
REF 35 miR-205 Exerts tumor-suppressive functions in human prostate through down-regulation of protein kinase Cepsilon. Cancer Res. 2009 Mar 15;69(6):2287-95.
REF 36 MicroRNA-708 induces apoptosis and suppresses tumorigenicity in renal cancer cells. Cancer Res. 2011 Oct 1;71(19):6208-19.
REF 37 miR-144 functions as a tumor suppressor in breast cancer through inhibiting ZEB1/2-mediated epithelial mesenchymal transition process. Onco Targets Ther. 2016 Oct 11;9:6247-6255.
REF 38 Regulatory Role of mir-203 in Prostate Cancer Progression and Metastasis. Clin Cancer Res. 2011 Aug 15;17(16):5287-98.
REF 39 miRNA profiling in metastatic renal cell carcinoma reveals a tumour-suppressor effect for miR-215. Br J Cancer. 2011 Nov 22;105(11):1741-9.
REF 40 Regulation of the expression and activity of the antiangiogenic homeobox gene GAX/MEOX2 by ZEB2 and microRNA-221. Mol Cell Biol. 2010 Aug;30(15):3902-13.
REF 41 MicroRNA-335 inhibits invasion and metastasis of colorectal cancer by targeting ZEB2. Med Oncol. 2014 Jun;31(6):982.
REF 42 MiR-338-3p inhibits epithelial-mesenchymal transition in gastric cancer cells by targeting ZEB2 and MACC1/Met/Akt signaling. Oncotarget. 2015 Jun 20;6(17):15222-34.
REF 43 MicroRNA-138 Regulates Metastatic Potential of Bladder Cancer Through ZEB2. Cell Physiol Biochem. 2015;37(6):2366-74.
REF 44 miR-154 targeting ZEB2 in hepatocellular carcinoma functions as a potential tumor suppressor. Oncol Rep. 2015 Dec;34(6):3272-9.
REF 45 MiR-4782-3p inhibited non-small cell lung cancer growth via USP14. Cell Physiol Biochem. 2014;33(2):457-67.
REF 46 miR-590-3p suppresses cancer cell migration, invasion and epithelial-mesenchymal transition in glioblastoma multiforme by targeting ZEB1 and ZEB2. Biochem Biophys Res Commun. 2015 Dec 25;468(4):739-45.

If You Find Any Error in Data or Bug in Web Service, Please Kindly Report It to Dr. Zhou and Dr. Zhang.