Target Regulator(s) Information (MicroRNA)

Content Navigation (  All   None )                                      
Target General Information
The microRNAs (miRNAs) Regulating This Target
References
Target General Information  Top
Target ID T40694 Target Info
Target Name Polo-like kinase 1 (PLK1)
Synonyms Serine/threonine-protein kinase PLK1; Serine/threonine-protein kinase 13; Serine-threonine protein kinase 13; STPK13; Plk1; PLK-1; PLK; Mitoticserine-threonine kinase polo-like kinase 1
Target Type Clinical trial Target
Gene Name PLK1
Biochemical Class Kinase
UniProt ID
P53350
The microRNAs (miRNAs) Regulating This Target  Top
miRNA Mature ID hsa-miR-100-5p miRNA Info
miRNA Mature AC
MIMAT0000098
Sequence aacccguagauccgaacuugug
miRNA Species Homo sapiens
Evidence Score (E-score) 6 +
1 Immunoblot; Immunohistochemistry; qRT-PCR; Western Blot [1]
2 Luciferase Reporter Assay; qRT-PCR; Western Blot [2]
3 Luciferase Reporter Assay; qRT-PCR; Western Blot [3]
4 Luciferase Reporter Assay; qRT-PCR; Western Blot [4]
5 Luciferase Reporter Assay; Western Blot [5]
6 Western Blot [6]
Representative Target(s) Regulated by This miRNA ATM serine/threonine kinase (ATM) Target Info
ATM_HUMAN
Bone morphogenetic protein receptor (BMPR2) Target Info
BMPR2_HUMAN
miRNA Mature ID hsa-miR-210-3p miRNA Info
miRNA Mature AC
MIMAT0000267
Sequence cugugcgugugacagcggcuga
miRNA Species Homo sapiens
Regulation Mechanism miRNA-210-3p regulates the expression of lnc-RI by directly binding to sites in PLK1 mRNA. [7]
Evidence Score (E-score) 2 +
1 Luciferase Reporter Assay [7]
2 Luciferase Reporter Assay [8]
Representative Target(s) Regulated by This miRNA Activin receptor type IB (ACVR1B) Target Info
ACV1B_HUMAN
Autophagy-related protein 7 (ATG7) Target Info
ATG7_HUMAN
miRNA Mature ID hsa-miR-296-5p miRNA Info
miRNA Mature AC
MIMAT0000690
Sequence agggcccccccucaauccugu
miRNA Species Homo sapiens
Regulation Mechanism PLK1 is a direct target of miR-296-5p. PLK1 protein expression was regulated by miR-296-5p through binding to the binding sites in its 3'-untranslated region (3'UTR). PLK1 protein expression was significantly downregulated by miR-296-5p transfection. [9]
Evidence Score (E-score) 2 +
1 Luciferase Reporter Assay; Western Blot [9]
2 Luciferase Reporter Assay; Western Blot [10]
Representative Target(s) Regulated by This miRNA Apoptosis regulator Bcl-2 (BCL-2) Target Info
BCL2_HUMAN
Bcl-2-binding component 3 (BBC3) Target Info
BBC3_HUMAN
miRNA Mature ID hsa-miR-10b-3p miRNA Info
miRNA Mature AC
MIMAT0004556
Sequence acagauucgauucuaggggaau
miRNA Species Homo sapiens
Regulation Mechanism The transfection with an inhibitor of miR-10b activity in untransformed MCF10A cells leads to an increase of PLK1. [11]
Evidence Score (E-score) 2 +
1 Luciferase Reporter Assay; Western Blot [11]
2 qRT-PCR [12]
Representative Target(s) Regulated by This miRNA BUB1 mitotic checkpoint serine/threonine kinase (BUB1) Target Info
BUB1_HUMAN
Cyclin A2 (CCNA2) Target Info
CCNA2_HUMAN
miRNA Mature ID hsa-miR-593-5p miRNA Info
miRNA Mature AC
MIMAT0003261
Sequence aggcaccagccaggcauugcucagc
miRNA Species Homo sapiens
Regulation Mechanism miR-593* suppresses PLK1 expression and reduces cell proliferation. [13]
Evidence Score (E-score) 2 +
1 Luciferase Reporter Assay; Western Blot [13]
2 Luciferase Reporter Assay; Western Blot [14]
Representative Target(s) Regulated by This miRNA Polo-like kinase 1 (PLK1) Target Info
PLK1_HUMAN
miRNA Mature ID hsa-let-7e-5p miRNA Info
miRNA Mature AC
MIMAT0000066
Sequence ugagguaggagguuguauaguu
miRNA Species Homo sapiens
Regulation Mechanism Overexpression of let-7e-5p resulted in downregulation of PLK1 protein expression. [15]
Evidence Score (E-score) 1 +
1 Western Blot [15]
Representative Target(s) Regulated by This miRNA Apoptosis antigen ligand (CD178) Target Info
TNFL6_HUMAN
Aurora kinase B (AURKB) Target Info
AURKB_HUMAN
miRNA Mature ID hsa-miR-22-3p miRNA Info
miRNA Mature AC
MIMAT0000077
Sequence aagcugccaguugaagaacugu
miRNA Species Homo sapiens
Regulation Mechanism Overexpression of let-7e-5p resulted in decreased protein level of PLK1 protein. [15]
Evidence Score (E-score) 1 +
1 Western Blot [15]
Representative Target(s) Regulated by This miRNA 5-HT 2C receptor (HTR2C) Target Info
5HT2C_HUMAN
ATP-citrate synthase (ACLY) Target Info
ACLY_HUMAN
miRNA Mature ID hsa-miR-509-3-5p miRNA Info
miRNA Mature AC
MIMAT0004975
Sequence uacugcagacguggcaaucaug
miRNA Species Homo sapiens
Regulation Mechanism miR-509-3-5p repressed PLK1 expression by targeting PLK1 3'UTR. [16]
Evidence Score (E-score) 1 +
1 Luciferase Reporter Assay; Western Blot [16]
Representative Target(s) Regulated by This miRNA Forkhead box protein M1 (FOXM1) Target Info
FOXM1_HUMAN
Polo-like kinase 1 (PLK1) Target Info
PLK1_HUMAN
miRNA Mature ID hsa-miR-3686 miRNA Info
miRNA Mature AC
MIMAT0018114
Sequence aucuguaagagaaaguaaauga
miRNA Species Homo sapiens
Regulation Mechanism Transfection with miR-3686 resulted in the decreased mRNA level of PLK1. [17]
Evidence Score (E-score) 1 +
1 Luciferase Reporter Assay; Western Blot [17]
Representative Target(s) Regulated by This miRNA Polo-like kinase 1 (PLK1) Target Info
PLK1_HUMAN
References  Top
REF 1 Reduced miR-100 expression in cervical cancer and precursors and its carcinogenic effect through targeting PLK1 protein. Eur J Cancer. 2011 Sep;47(14):2166-74.
REF 2 MicroRNA-100 is a potential molecular marker of non-small cell lung cancer and functions as a tumor suppressor by targeting polo-like kinase 1. BMC Cancer. 2012 Nov 14;12:519.
REF 3 MiR-100 resensitizes docetaxel-resistant human lung adenocarcinoma cells (SPC-A1) to docetaxel by targeting Plk1. Cancer Lett. 2012 Apr 28;317(2):184-91.
REF 4 Significance of Plk1 regulation by miR-100 in human nasopharyngeal cancer. Int J Cancer. 2010 May 1;126(9):2036-48.
REF 5 Downregulation of microRNA-100 correlates with tumor progression and poor prognosis in hepatocellular carcinoma. Mol Cell Biochem. 2013 Nov;383(1-2):49-58.
REF 6 Sequential analysis of multistage hepatocarcinogenesis reveals that miR-100 and PLK1 dysregulation is an early event maintained along tumor progression. Oncogene. 2012 Oct 18;31(42):4517-26.
REF 7 Long noncoding RNA lnc-RI is a new regulator of mitosis via targeting miRNA-210-3p to release PLK1 mRNA activity. Sci Rep. 2016 May 10;6:25385.
REF 8 MiR-210 disturbs mitotic progression through regulating a group of mitosis-related genes. Nucleic Acids Res. 2013 Jan 7;41(1):498-508.
REF 9 miR-296-5p suppresses cell viability by directly targeting PLK1 in non-small cell lung cancer. Oncol Rep. 2016 Jan;35(1):497-503.
REF 10 CircPLK1 sponges miR-296-5p to facilitate triple-negative breast cancer progression. Epigenomics. 2019 Aug;11(10):1163-1176.
REF 11 miR-10b*, a master inhibitor of the cell cycle, is down-regulated in human breast tumours. EMBO Mol Med. 2012 Nov;4(11):1214-29.
REF 12 Downregulation of miR-10B* is correlated with altered expression of mitotic kinases in osteosarcoma. Pathol Res Pract. 2018 Feb;214(2):213-216.
REF 13 Polo-like kinase 1 regulates cell proliferation and is targeted by miR-593* in esophageal cancer. Int J Cancer. 2011 Nov 1;129(9):2134-46.
REF 14 [miR-593 inhibits proliferation of colon cancer cells in vitro by down-regulating PLK1]. Nan Fang Yi Ke Da Xue Xue Bao. 2019 Feb 28;39(2):144-149.
REF 15 Identification of post-transcriptional regulatory networks during myeloblast-to-monocyte differentiation transition. RNA Biol. 2015;12(7):690-700.
REF 16 MiR-509-3-5p causes aberrant mitosis and anti-proliferative effect by suppression of PLK1 in human lung cancer A549 cells. Biochem Biophys Res Commun. 2016 Sep 16;478(2):676-82.
REF 17 The MicroRNA3686 Inhibits the Proliferation of Pancreas Carcinoma Cell Line by Targeting the Polo-Like Kinase 1. Biomed Res Int. 2015;2015:954870.

If You Find Any Error in Data or Bug in Web Service, Please Kindly Report It to Dr. Zhou and Dr. Zhang.