Target Regulator(s) Information (MicroRNA)

Content Navigation (  All   None )                                      
Target General Information
The microRNAs (miRNAs) Regulating This Target
References
Target General Information  Top
Target ID T47101 Target Info
Target Name Fibroblast growth factor receptor 1 (FGFR1)
Synonyms c-fgr; bFGF-R-1; bFGF-R; N-sam; HBGFR; Fms-like tyrosine kinase 2; FLT2; FLT-2; FLG; FGFR-1; FGFBR; CEK; CD331 antigen; CD331; Basic fibroblast growth factor receptor 1; BFGFR
Target Type Successful Target
Gene Name FGFR1
Biochemical Class Kinase
UniProt ID
P11362
The microRNAs (miRNAs) Regulating This Target  Top
miRNA Mature ID hsa-miR-424-5p miRNA Info
miRNA Mature AC
MIMAT0001341
Sequence cagcagcaauucauguuuugaa
miRNA Species Homo sapiens
Regulation Mechanism The overexpression of miR-424-5p by mature miRNA mimics tranfection resulted in the decreased protein level of target FGFR1. [2]
Evidence Score (E-score) 3 +
1 Immunohistochemistry; Luciferase Reporter Assay; Microarray; Northern Blot; qRT-PCR [1]
2 Immunohistochemistry; Luciferase Reporter Assay; Microarray; Northern Blot; qRT-PCR [2]
3 Luciferase Reporter Assay; qRT-PCR; Western Blot [3]
Representative Target(s) Regulated by This miRNA Checkpoint kinase-1 (CHK1) Target Info
CHK1_HUMAN
Cyclin D (CCND3) Target Info
CCND3_HUMAN
miRNA Mature ID hsa-miR-133b miRNA Info
miRNA Mature AC
MIMAT0000770
Sequence uuugguccccuucaaccagcua
miRNA Species Homo sapiens
Regulation Mechanism FGFR1 is a target gene of miR-133b. [5]
Evidence Score (E-score) 2 +
1 Luciferase Reporter Assay; Western Blot [4]
2 Luciferase Reporter Assay; Western Blot; Immunohistochemistry [5]
Representative Target(s) Regulated by This miRNA Apoptosis mediating surface antigen FAS (FAS) Target Info
TNR6_HUMAN
Apoptosis regulator Bcl-W (BCL-W) Target Info
B2CL2_HUMAN
miRNA Mature ID hsa-miR-198 miRNA Info
miRNA Mature AC
MIMAT0000228
Sequence gguccagaggggagauagguuc
miRNA Species Homo sapiens
Regulation Mechanism miR-198 targets FGFR1. [6]
Evidence Score (E-score) 2 +
1 Luciferase Reporter Assay [6]
2 Luciferase Reporter Assay; Western Blot; RT-PCR [7]
Representative Target(s) Regulated by This miRNA Fibroblast growth factor receptor 1 (FGFR1) Target Info
FGFR1_HUMAN
Janus kinase 3 (JAK-3) Target Info
JAK3_HUMAN
miRNA Mature ID hsa-miR-214-3p miRNA Info
miRNA Mature AC
MIMAT0000271
Sequence acagcaggcacagacaggcagu
miRNA Species Homo sapiens
Regulation Mechanism Fibroblast growth factor receptor 1 (FGFR-1) is a miR-214 target gene implicated in the progression of HCC. [9]
Evidence Score (E-score) 2 +
1 In Situ Hybridization; Luciferase Reporter Assay; Microarray; qRT-PCR; Western Blot [8]
2 Luciferase Reporter Assay [9]
Representative Target(s) Regulated by This miRNA Activating transcription factor 4 (ATF-4) Target Info
ATF4_HUMAN
ADP-ribosylation factor-like protein 2 (ARL2) Target Info
ARL2_HUMAN
miRNA Mature ID hsa-miR-149-5p miRNA Info
miRNA Mature AC
MIMAT0000450
Sequence ucuggcuccgugucuucacuccc
miRNA Species Homo sapiens
Regulation Mechanism miR-149-5p targets FGFR1. [10]
Evidence Score (E-score) 1 +
1 Luciferase Reporter Assay; Western Blot [10]
Representative Target(s) Regulated by This miRNA Apoptosis antigen ligand (CD178) Target Info
TNFL6_HUMAN
Bcl-2-binding component 3 (BBC3) Target Info
BBC3_HUMAN
miRNA Mature ID hsa-miR-16-5p miRNA Info
miRNA Mature AC
MIMAT0000069
Sequence uagcagcacguaaauauuggcg
miRNA Species Homo sapiens
Regulation Mechanism The overexpression of miR-16-5p by mature miRNA mimics tranfection resulted in the decreased protein level of target FGFR1. [2]
Evidence Score (E-score) 1 +
1 Western Blot; qRT-PCR; Luciferase Reporter Assay [2]
Representative Target(s) Regulated by This miRNA Apoptosis regulator Bcl-2 (BCL-2) Target Info
BCL2_HUMAN
Corticotropin-releasing factor binding protein (CRHBP) Target Info
CRHBP_HUMAN
miRNA Mature ID hsa-miR-296-5p miRNA Info
miRNA Mature AC
MIMAT0000690
Sequence agggcccccccucaauccugu
miRNA Species Homo sapiens
Regulation Mechanism Fibroblast growth factor receptor 1 (FGFR1) is a downstream target that mediates the functions of miR-296 in HCC. [11]
Evidence Score (E-score) 1 +
1 Immunohistochemistry; Luciferase Reporter Assay; Western Blot [11]
Representative Target(s) Regulated by This miRNA Apoptosis regulator Bcl-2 (BCL-2) Target Info
BCL2_HUMAN
Bcl-2-binding component 3 (BBC3) Target Info
BBC3_HUMAN
miRNA Mature ID hsa-miR-503-5p miRNA Info
miRNA Mature AC
MIMAT0002874
Sequence uagcagcgggaacaguucugcag
miRNA Species Homo sapiens
Regulation Mechanism miR-503 downregulation correlates with FGFR1 upregulation in PAH PAECs. [1]
Evidence Score (E-score) 1 +
1 Immunohistochemistry; Luciferase Reporter Assay; Northern Blot [1]
Representative Target(s) Regulated by This miRNA Apoptosis regulator Bcl-2 (BCL-2) Target Info
BCL2_HUMAN
CD40L receptor (CD40) Target Info
TNR5_HUMAN
miRNA Mature ID hsa-miR-149-3p miRNA Info
miRNA Mature AC
MIMAT0004609
Sequence agggagggacgggggcugugc
miRNA Species Homo sapiens
Regulation Mechanism miR-149-3p targets FGFR1. [10]
Evidence Score (E-score) 1 +
1 Luciferase Reporter Assay; Western Blot [10]
Representative Target(s) Regulated by This miRNA E2F transcription factor 1 (E2F1) Target Info
E2F1_HUMAN
Fibroblast growth factor receptor 1 (FGFR1) Target Info
FGFR1_HUMAN
miRNA Mature ID hsa-miR-573 miRNA Info
miRNA Mature AC
MIMAT0003238
Sequence cugaagugauguguaacugaucag
miRNA Species Homo sapiens
Regulation Mechanism FGFR1 is directly targeted by miR-573 during EMT process. [12]
Evidence Score (E-score) 1 +
1 Luciferase Reporter Assay; Western Blot [12]
Representative Target(s) Regulated by This miRNA Cell surface glycoprotein MUC18 (MCAM) Target Info
MUC18_HUMAN
Fibroblast growth factor receptor 1 (FGFR1) Target Info
FGFR1_HUMAN
References  Top
REF 1 An endothelial apelin-FGF link mediated by miR-424 and miR-503 is disrupted in pulmonary arterial hypertension. Nat Med. 2013 Jan;19(1):74-82.
REF 2 MiR-205 silences MED1 in hypoxic primary human trophoblasts. FASEB J. 2010 Jun;24(6):2030-9.
REF 3 The unique expression and function of miR-424 in human placental trophoblasts. Biol Reprod. 2013 Aug 1;89(2):25.
REF 4 miRNA-133b targets FGFR1 and presents multiple tumor suppressor activities in osteosarcoma. Cancer Cell Int. 2018 Dec 18;18:210.
REF 5 miR-133b acts as a tumor suppressor and negatively regulates FGFR1 in gastric cancer. Tumour Biol. 2013 Apr;34(2):793-803.
REF 6 MicroRNA-198 inhibits proliferation and induces apoptosis of lung cancer cells via targeting FGFR1. J Cell Biochem. 2014 May;115(5):987-95.
REF 7 MicroRNA-198 inhibits proliferation and induces apoptosis by directly suppressing FGFR1 in gastric cancer. Biosci Rep. 2019 Jun 10;39(6). pii: BSR20181258.
REF 8 Identification of microRNA-214 as a negative regulator of colorectal cancer liver metastasis by way of regulation of fibroblast growth factor receptor 1 expression. Hepatology. 2014 Aug;60(2):598-609.
REF 9 Downregulation of microRNA-214 and overexpression of FGFR-1 contribute to hepatocellular carcinoma metastasis. Biochem Biophys Res Commun. 2013 Sep 13;439(1):47-53.
REF 10 Autoregulation of glypican-1 by intronic microRNA-149 fine tunes the angiogenic response to FGF2 in human endothelial cells. J Cell Sci. 2014 Mar 15;127(Pt 6):1169-78.
REF 11 miR-296 inhibits proliferation and induces apoptosis by targeting FGFR1 in human hepatocellular carcinoma. FEBS Lett. 2016 Dec;590(23):4252-4262.
REF 12 MiR-573 inhibits prostate cancer metastasis by regulating epithelial-mesenchymal transition. Oncotarget. 2015 Nov 3;6(34):35978-90.

If You Find Any Error in Data or Bug in Web Service, Please Kindly Report It to Dr. Zhou and Dr. Zhang.