Target Regulator(s) Information (MicroRNA)

Content Navigation (  All   None )                                      
Target General Information
The microRNAs (miRNAs) Regulating This Target
References
Target General Information  Top
Target ID T08919 Target Info
Target Name Epithelial cadherin (CDH1)
Synonyms Uvomorulin; UVO; E-cadherin gene; E-cadherin; Cadherin-1; CDHE; CD324; CAM 120/80
Target Type Literature-reported Target
Gene Name CDH1
UniProt ID
P12830
The microRNAs (miRNAs) Regulating This Target  Top
miRNA Mature ID hsa-miR-200c-5p miRNA Info
miRNA Mature AC
MIMAT0004657
Sequence cgucuuacccagcaguguuugg
miRNA Species Homo sapiens
Regulation Mechanism Levels of CDH1 were reduced by knockdown of miR-200c in HCT-116 cells. [2]
Evidence Score (E-score) 2 +
1 Immunohistochemical Analysis [1]
2 Western Blot [2]
Representative Target(s) Regulated by This miRNA Cytochrome P450 1B1 (CYP1B1) Target Info
CP1B1_HUMAN
Epithelial cadherin (CDH1) Target Info
CADH1_HUMAN
miRNA Mature ID hsa-miR-204-5p miRNA Info
miRNA Mature AC
MIMAT0000265
Sequence uucccuuugucauccuaugccu
miRNA Species Homo sapiens
Evidence Score (E-score) 2 +
1 Luciferase Reporter Assay; Western Blot [3]
2 Western Blot [4]
Representative Target(s) Regulated by This miRNA Alkaline phosphatase tissue-nonspecific (ALPL) Target Info
PPBT_HUMAN
Apoptosis regulator Bcl-2 (BCL-2) Target Info
BCL2_HUMAN
miRNA Mature ID hsa-miR-224-5p miRNA Info
miRNA Mature AC
MIMAT0000281
Sequence ucaagucacuagugguuccguuuag
miRNA Species Homo sapiens
Regulation Mechanism Overexpression of miR-224 was associated with significant downregulation of CDH1. [6]
Evidence Score (E-score) 2 +
1 Luciferase Reporter Assay; Western Blot [5]
2 qRT-PCR [6]
Representative Target(s) Regulated by This miRNA APJ endogenous ligand (Apelin) Target Info
APEL_HUMAN
Apoptosis regulator Bcl-2 (BCL-2) Target Info
BCL2_HUMAN
miRNA Mature ID hsa-miR-25-3p miRNA Info
miRNA Mature AC
MIMAT0000081
Sequence cauugcacuugucucggucuga
miRNA Species Homo sapiens
Regulation Mechanism miR-25 directly targeted CDH1 3' -untranslated region (3'UTR) and repressed the expression of CDH1. [7]
Evidence Score (E-score) 2 +
1 Luciferase Reporter Assay; Western Blot [7]
2 Western Blot [8]
Representative Target(s) Regulated by This miRNA CDK inhibitor 1C p57Kip2 (CDKN1C) Target Info
CDN1C_HUMAN
Cellular tumor antigen p53 (TP53) Target Info
P53_HUMAN
miRNA Mature ID hsa-miR-544a miRNA Info
miRNA Mature AC
MIMAT0003164
Sequence auucugcauuuuuagcaaguuc
miRNA Species Homo sapiens
Regulation Mechanism CDH1 is one of the target genes of miR-544a. [10]
Evidence Score (E-score) 2 +
1 Immunofluorescence; Luciferase Reporter Assay; qRT-PCR; Western Blot [9]
2 Luciferase Reporter Assay; Western Blot [10]
Representative Target(s) Regulated by This miRNA Epithelial cadherin (CDH1) Target Info
CADH1_HUMAN
Polycomb complex protein BMI-1 (BMI1) Target Info
BMI1_HUMAN
miRNA Mature ID hsa-miR-203a-3p miRNA Info
miRNA Mature AC
MIMAT0000264
Sequence gugaaauguuuaggaccacuag
miRNA Species Homo sapiens
Evidence Score (E-score) 1 +
1 qRT-PCR; Western Blot [11]
Representative Target(s) Regulated by This miRNA Apoptosis inhibitor survivin (BIRC5) Target Info
BIRC5_HUMAN
Apoptosis regulator Bcl-W (BCL-W) Target Info
B2CL2_HUMAN
miRNA Mature ID hsa-miR-23a-3p miRNA Info
miRNA Mature AC
MIMAT0000078
Sequence aucacauugccagggauuucc
miRNA Species Homo sapiens
Evidence Score (E-score) 1 +
1 qRT-PCR; Western Blot [12]
Representative Target(s) Regulated by This miRNA Apoptosis mediating surface antigen FAS (FAS) Target Info
TNR6_HUMAN
DNA topoisomerase I (TOP1) Target Info
TOP1_HUMAN
miRNA Mature ID hsa-miR-30a-5p miRNA Info
miRNA Mature AC
MIMAT0000087
Sequence uguaaacauccucgacuggaag
miRNA Species Homo sapiens
Evidence Score (E-score) 1 +
1 In Situ Hybridization; Western Blot [13]
Representative Target(s) Regulated by This miRNA Beclin-1 (BECN1) Target Info
BECN1_HUMAN
Brain-derived neurotrophic factor (BDNF) Target Info
BDNF_HUMAN
miRNA Mature ID hsa-miR-34c-5p miRNA Info
miRNA Mature AC
MIMAT0000686
Sequence aggcaguguaguuagcugauugc
miRNA Species Homo sapiens
Evidence Score (E-score) 1 +
1 qRT-PCR [14]
Representative Target(s) Regulated by This miRNA Apoptosis regulator Bcl-2 (BCL-2) Target Info
BCL2_HUMAN
Cyclin-dependent kinase 4 (CDK4) Target Info
CDK4_HUMAN
miRNA Mature ID hsa-miR-9-5p miRNA Info
miRNA Mature AC
MIMAT0000441
Sequence ucuuugguuaucuagcuguauga
miRNA Species Homo sapiens
Evidence Score (E-score) 1 +
1 Luciferase Reporter Assay [15]
Representative Target(s) Regulated by This miRNA Beta-secretase 1 (BACE1) Target Info
BACE1_HUMAN
DNA-binding factor KBF1 (p105) Target Info
NFKB1_HUMAN
miRNA Mature ID hsa-miR-1323 miRNA Info
miRNA Mature AC
MIMAT0005795
Sequence ucaaaacugaggggcauuuucu
miRNA Species Homo sapiens
Evidence Score (E-score) 1 +
1 qRT-PCR [14]
Representative Target(s) Regulated by This miRNA Epithelial cadherin (CDH1) Target Info
CADH1_HUMAN
Heat shock protein 90 alpha (HSP90A) Target Info
HS90A_HUMAN
miRNA Mature ID hsa-miR-371a-5p miRNA Info
miRNA Mature AC
MIMAT0004687
Sequence acucaaacugugggggcacu
miRNA Species Homo sapiens
Evidence Score (E-score) 1 +
1 qRT-PCR [14]
Representative Target(s) Regulated by This miRNA Epithelial cadherin (CDH1) Target Info
CADH1_HUMAN
Heat shock protein 90 alpha (HSP90A) Target Info
HS90A_HUMAN
miRNA Mature ID hsa-miR-421 miRNA Info
miRNA Mature AC
MIMAT0003339
Sequence aucaacagacauuaauugggcgc
miRNA Species Homo sapiens
Regulation Mechanism CDH1 was a target of miR-421. Overexpression of miR-421 promoted metastasis, inhibited apoptosis, and induced cisplatin resistance in gastric cancer in vivo and in vitro. [16]
Evidence Score (E-score) 1 +
1 Luciferase Reporter Assay; Immunofluorescence; Immunohistochemistry; Western Blot [16]
Representative Target(s) Regulated by This miRNA ATM serine/threonine kinase (ATM) Target Info
ATM_HUMAN
Caspase-3 (CASP3) Target Info
CASP3_HUMAN
miRNA Mature ID hsa-miR-888-5p miRNA Info
miRNA Mature AC
MIMAT0004916
Sequence uacucaaaaagcugucaguca
miRNA Species Homo sapiens
Regulation Mechanism miR-888 suppresses CDH1 expression by targeting its 3'UTR. [17]
Evidence Score (E-score) 1 +
1 Luciferase Reporter Assay; Western Blot [17]
Representative Target(s) Regulated by This miRNA Epithelial cadherin (CDH1) Target Info
CADH1_HUMAN
References  Top
REF 1 miR-200c and phospho-AKT as prognostic factors and mediators of osteosarcoma progression and lung metastasis. Mol Oncol. 2016 Aug;10(7):1043-53.
REF 2 The Effect of miR-200c Inhibition on Chemosensitivity (5- FluoroUracil) in Colorectal Cancer. Pathol Oncol Res. 2018 Jan;24(1):145-151.
REF 3 miR-204 inhibits epithelial to mesenchymal transition by targeting slug in intrahepatic cholangiocarcinoma cells. Cell Physiol Biochem. 2013;32(5):1331-41.
REF 4 Proinflammatory cytokines decrease the expression of genes critical for RPE function. Mol Vis. 2016 Oct 8;22:1156-1168.
REF 5 The clinical and biological significance of MIR-224 expression in colorectal cancer metastasis. Gut. 2016 Jun;65(6):977-989.
REF 6 Involvement of microRNA-224 in cell proliferation, migration, invasion, and anti-apoptosis in hepatocellular carcinoma. J Gastroenterol Hepatol. 2013 Mar;28(3):565-75.
REF 7 MicroRNA-25 promotes cell migration and invasion in esophageal squamous cell carcinoma. Biochem Biophys Res Commun. 2012 May 18;421(4):640-5.
REF 8 miR-25 promotes invasion of human non-small cell lung cancer via CDH1. Bioengineered. 2019 Dec;10(1):271-281.
REF 9 miR-544a induces epithelial-mesenchymal transition through the activation of WNT signaling pathway in gastric cancer. Carcinogenesis. 2015 Nov;36(11):1363-71.
REF 10 miR-544a promotes the invasion of lung cancer cells by targeting cadherina 1 in vitro. Onco Targets Ther. 2014 Jun 4;7:895-900.
REF 11 microRNA-203 suppresses invasion of gastric cancer cells by targeting ERK1/2/Slug/ E-cadherin signaling. Cancer Biomark. 2017;19(1):11-20.
REF 12 MiR-23a regulates TGF--induced epithelial-mesenchymal transition by targeting E-cadherin in lung cancer cells. Int J Oncol. 2012 Sep;41(3):869-75.
REF 13 MicroRNA-30a promotes invasiveness and metastasis initro and inivo through epithelial-mesenchymal transition and results in poor survival of na... Exp Biol Med (Maywood). 2014 Jul;239(7):891-898.
REF 14 Genome-wide analyses of radioresistance-associated miRNA expression profile in nasopharyngeal carcinoma using next generation deep sequencing. PLoS One. 2013 Dec 19;8(12):e84486.
REF 15 miR-9, a MYC/MYCN-activated microRNA, regulates E-cadherin and cancer metastasis. Nat Cell Biol. 2010 Mar;12(3):247-56.
REF 16 MicroRNA-421 regulated by HIF-1 promotes metastasis, inhibits apoptosis, and induces cisplatin resistance by targeting E-cadherin and caspase-3 in gastric cancer. Oncotarget. 2016 Apr 26;7(17):24466-82.
REF 17 miR-888 in MCF-7 side population sphere cells directly targets E-cadherin. J Genet Genomics. 2014 Jan 20;41(1):35-42.

If You Find Any Error in Data or Bug in Web Service, Please Kindly Report It to Dr. Zhou and Dr. Zhang.