Target Regulator(s) Information (MicroRNA)

Content Navigation (  All   None )                                      
Target General Information
The microRNAs (miRNAs) Regulating This Target
References
Target General Information  Top
Target ID T14912 Target Info
Target Name Induced myeloid leukemia cell differentiation protein Mcl-1 (MCL1)
Synonyms mcl1/EAT; Bcl2-L-3; Bcl-2-related protein EAT/mcl1; Bcl-2-like protein 3; BCL2L3
Target Type Clinical trial Target
Gene Name MCL1
Biochemical Class B-cell lymphoma Bcl-2
UniProt ID
Q07820
The microRNAs (miRNAs) Regulating This Target  Top
miRNA Mature ID hsa-miR-193a-3p miRNA Info
miRNA Mature AC
MIMAT0000459
Sequence aacuggccuacaaagucccagu
miRNA Species Homo sapiens
Regulation Mechanism The overexpression of miR-193a-3p by mature miRNA precursor transfection resulted in the decreased protein level of target MCL1. [2]
Evidence Score (E-score) 6 +
1 ELISA; qRT-PCR; Western Blot [1]
2 ELISA; qRT-PCR; Western Blot [2]
3 Immunofluorescence; Luciferase Reporter Assay; Western Blot; qRT-PCR [3]
4 Luciferase Reporter Assay; Microarray; qRT-PCR; Western Blot [4]
5 Luciferase Reporter Assay; qRT-PCR; Western Blot [5]
6 Luciferase Reporter Assay; Western Blot [6]
Representative Target(s) Regulated by This miRNA E2F transcription factor 1 (E2F1) Target Info
E2F1_HUMAN
Erbb2 tyrosine kinase receptor (HER2) Target Info
ERBB2_HUMAN
miRNA Mature ID hsa-miR-29a-3p miRNA Info
miRNA Mature AC
MIMAT0000086
Sequence uagcaccaucugaaaucgguua
miRNA Species Homo sapiens
Regulation Mechanism The overexpression of miR-29a-3p resulted in the decreased protein level of target MCL1. [2]
Evidence Score (E-score) 5 +
1 Immunohistochemistry; Microarray; Western Blot [7]
2 Immunohistochemistry; Microarray; Western Blot [2]
3 Luciferase Reporter Assay [8]
4 Luciferase Reporter Assay; qRT-PCR; Western Blot [9]
5 qRT-PCR; Western Blot [10]
Representative Target(s) Regulated by This miRNA Apoptosis regulator Bcl-2 (BCL-2) Target Info
BCL2_HUMAN
Aryl hydrocarbon receptor (AHR) Target Info
AHR_HUMAN
miRNA Mature ID hsa-miR-133b miRNA Info
miRNA Mature AC
MIMAT0000770
Sequence uuugguccccuucaaccagcua
miRNA Species Homo sapiens
Regulation Mechanism miR-133b directly targets the 3 UTRs of MCL1. [14]
Evidence Score (E-score) 4 +
1 ChIP; Luciferase Reporter Assay; qRT-PCR; Western Blot [11]
2 Luciferase Reporter Assay; Western Blot [12]
3 Western Blot [13]
4 Western Blot; Luciferase Reporter Assay [14]
Representative Target(s) Regulated by This miRNA Apoptosis mediating surface antigen FAS (FAS) Target Info
TNR6_HUMAN
Apoptosis regulator Bcl-W (BCL-W) Target Info
B2CL2_HUMAN
miRNA Mature ID hsa-miR-29c-3p miRNA Info
miRNA Mature AC
MIMAT0000681
Sequence uagcaccauuugaaaucgguua
miRNA Species Homo sapiens
Regulation Mechanism Mcl-1 is Direct Target of miR-29. [9]
Evidence Score (E-score) 4 +
1 ChIP; Immunohistochemistry; In Situ Hybridization; Microarray; qRT-PCR; Western Blot [15]
2 Immunohistochemistry; Microarray; Western Blot [7]
3 Luciferase Reporter Assay [16]
4 Luciferase Reporter Assay; Western Blot [9]
Representative Target(s) Regulated by This miRNA Apoptosis regulator Bcl-2 (BCL-2) Target Info
BCL2_HUMAN
B7 homolog 3 (CD276) Target Info
CD276_HUMAN
miRNA Mature ID hsa-miR-193b-3p miRNA Info
miRNA Mature AC
MIMAT0002819
Sequence aacuggcccucaaagucccgcu
miRNA Species Homo sapiens
Evidence Score (E-score) 3 +
1 Luciferase Reporter Assay; qRT-PCR; Western Blot [17]
2 Luciferase Reporter Assay; qRT-PCR; Western Blot [18]
3 Luciferase Reporter Assay; Western Blot [19]
Representative Target(s) Regulated by This miRNA DNA repair protein RAD51 homolog 1 (RAD51) Target Info
RAD51_HUMAN
Estrogen receptor (ESR) Target Info
ESR1_HUMAN
miRNA Mature ID hsa-miR-139-5p miRNA Info
miRNA Mature AC
MIMAT0000250
Sequence ucuacagugcacgugucuccagu
miRNA Species Homo sapiens
Regulation Mechanism miR-139 directly targets Mcl-1 and induces apoptosis in cooperation with TMZ targeting Mcl-1 in glioma. [21]
Evidence Score (E-score) 2 +
1 Immunohistochemistry; Luciferase Reporter Assay; qRT-PCR; Western Blot [20]
2 Immunohistochemistry; Luciferase Reporter Assay; Western Blot [21]
Representative Target(s) Regulated by This miRNA Apoptosis regulator Bcl-2 (BCL-2) Target Info
BCL2_HUMAN
C-X-C chemokine receptor type 4 (CXCR4) Target Info
CXCR4_HUMAN
miRNA Mature ID hsa-miR-302b-3p miRNA Info
miRNA Mature AC
MIMAT0000715
Sequence uaagugcuuccauguuuuaguag
miRNA Species Homo sapiens
Regulation Mechanism miR-302b directly targets Mcl-1 by binding to the 3'UTR and DPYD coding region. [23]
Evidence Score (E-score) 2 +
1 Luciferase Reporter Assay; [22]
2 Luciferase Reporter Assay; Western Blot [23]
Representative Target(s) Regulated by This miRNA Cyclin-dependent kinase 2 (CDK2) Target Info
CDK2_HUMAN
Dihydrothymine dehydrogenase (DPYD) Target Info
DPYD_HUMAN
miRNA Mature ID hsa-miR-101-3p miRNA Info
miRNA Mature AC
MIMAT0000099
Sequence uacaguacugugauaacugaa
miRNA Species Homo sapiens
Evidence Score (E-score) 1 +
1 Luciferase Reporter Assay [2]
Representative Target(s) Regulated by This miRNA ATM serine/threonine kinase (ATM) Target Info
ATM_HUMAN
Enhancer of zeste homolog 2 (EZH2) Target Info
EZH2_HUMAN
miRNA Mature ID hsa-miR-125a-5p miRNA Info
miRNA Mature AC
MIMAT0000443
Sequence ucccugagacccuuuaaccuguga
miRNA Species Homo sapiens
Regulation Mechanism Anti-apoptotic gene Mcl-1 is a direct target of miR-125a-5p in colon cancer cells. [24]
Evidence Score (E-score) 1 +
1 Luciferase Reporter Assay; Western Blot [24]
Representative Target(s) Regulated by This miRNA Apoptosis regulator BAK (BAK) Target Info
BAK_HUMAN
Apoptosis regulator Bcl-2 (BCL-2) Target Info
BCL2_HUMAN
miRNA Mature ID hsa-miR-20a-5p miRNA Info
miRNA Mature AC
MIMAT0000075
Sequence uaaagugcuuauagugcagguag
miRNA Species Homo sapiens
Regulation Mechanism miR-20a directly targeted myeloid cell leukemia sequence 1 (Mcl-1) and reduced the endogenous protein level of Mcl-1 in HCC cells. [25]
Evidence Score (E-score) 1 +
1 Immunohistochemistry; Luciferase Reporter Assay; Western Blot [25]
Representative Target(s) Regulated by This miRNA Amyloid beta A4 protein (APP) Target Info
A4_HUMAN
Apoptosis regulator Bcl-2 (BCL-2) Target Info
BCL2_HUMAN
miRNA Mature ID hsa-miR-29b-3p miRNA Info
miRNA Mature AC
MIMAT0000100
Sequence uagcaccauuugaaaucaguguu
miRNA Species Homo sapiens
Regulation Mechanism The overexpression of miR-29b-3p resulted in the decreased protein level of target MCL1. [2]
Evidence Score (E-score) 1 +
1 Western Blot; Luciferase Reporter Assay [2]
Representative Target(s) Regulated by This miRNA Beta-secretase 1 (BACE1) Target Info
BACE1_HUMAN
Cyclin-dependent kinase 6 (CDK6) Target Info
CDK6_HUMAN
miRNA Mature ID hsa-miR-582-5p miRNA Info
miRNA Mature AC
MIMAT0003247
Sequence uuacaguuguucaaccaguuacu
miRNA Species Homo sapiens
Regulation Mechanism miR-582 reduced the expression of MCL1. [6]
Evidence Score (E-score) 1 +
1 Luciferase Reporter Assay; Western Blot [6]
Representative Target(s) Regulated by This miRNA Caspase-3 (CASP3) Target Info
CASP3_HUMAN
Caspase-9 (CASP9) Target Info
CASP9_HUMAN
miRNA Mature ID hsa-miR-892b miRNA Info
miRNA Mature AC
MIMAT0004918
Sequence cacuggcuccuuucuggguaga
miRNA Species Homo sapiens
Regulation Mechanism miR-892b reduced the expression of MCL1. [6]
Evidence Score (E-score) 1 +
1 Luciferase Reporter Assay; Western Blot [6]
Representative Target(s) Regulated by This miRNA Cyclin-dependent kinase 2 (CDK2) Target Info
CDK2_HUMAN
Cyclin-dependent kinase 6 (CDK6) Target Info
CDK6_HUMAN
miRNA Mature ID hsa-miR-153-3p miRNA Info
miRNA Mature AC
MIMAT0000439
Sequence uugcauagucacaaaagugauc
miRNA Species Homo sapiens
Regulation Mechanism The overexpression of miR-153-3p resulted in the decreased protein level of target MCL1. [2]
Evidence Score (E-score) 1 +
1 Western Blot; qRT-PCR; Luciferase Reporter Assay [2]
Representative Target(s) Regulated by This miRNA Apoptosis regulator Bcl-2 (BCL-2) Target Info
BCL2_HUMAN
Forkhead box protein O1A (FOXO1) Target Info
FOXO1_HUMAN
miRNA Mature ID hsa-miR-339-3p miRNA Info
miRNA Mature AC
MIMAT0004702
Sequence ugagcgccucgacgacagagccg
miRNA Species Homo sapiens
Regulation Mechanism MCL1 was defined as a target for downregulation by miR-339-3p, functioning through direct interaction with the 3'UTR of MCL1 mRNA. miR-339-3p directly targets MCL1. [26]
Evidence Score (E-score) 1 +
1 Luciferase Reporter Assay [26]
Representative Target(s) Regulated by This miRNA DNA-binding factor KBF1 (p105) Target Info
NFKB1_HUMAN
Forkhead box protein O1A (FOXO1) Target Info
FOXO1_HUMAN
miRNA Mature ID hsa-miR-661 miRNA Info
miRNA Mature AC
MIMAT0003324
Sequence ugccugggucucuggccugcgcgu
miRNA Species Homo sapiens
Regulation Mechanism miR-661 reduced the expression of MCL1. [6]
Evidence Score (E-score) 1 +
1 Luciferase Reporter Assay; Western Blot [6]
Representative Target(s) Regulated by This miRNA Induced myeloid leukemia cell differentiation protein Mcl-1 (MCL1) Target Info
MCL1_HUMAN
Metastasis associated gene-1 (MTA1) Target Info
MTA1_HUMAN
miRNA Mature ID hsa-miR-148b-5p miRNA Info
miRNA Mature AC
MIMAT0004699
Sequence aaguucuguuauacacucaggc
miRNA Species Homo sapiens
Regulation Mechanism miR-148b reduced the expression of MCL1. [6]
Evidence Score (E-score) 1 +
1 Luciferase Reporter Assay; Western Blot [6]
Representative Target(s) Regulated by This miRNA Induced myeloid leukemia cell differentiation protein Mcl-1 (MCL1) Target Info
MCL1_HUMAN
miRNA Mature ID hsa-miR-320a-3p miRNA Info
miRNA Mature AC
MIMAT0000510
Sequence aaaagcuggguugagagggcga
miRNA Species Homo sapiens
Regulation Mechanism The overexpression of miR-320a-3p by mature miRNA precursor transfection resulted in the decreased protein level of target MCL1. [2]
Evidence Score (E-score) 1 +
1 Western Blot; Luciferase Reporter Assay [2]
Representative Target(s) Regulated by This miRNA Induced myeloid leukemia cell differentiation protein Mcl-1 (MCL1) Target Info
MCL1_HUMAN
miRNA Mature ID hsa-miR-761 miRNA Info
miRNA Mature AC
MIMAT0010364
Sequence gcagcagggugaaacugacaca
miRNA Species Homo sapiens
Evidence Score (E-score) 1 +
1 Immunoblot [27]
Representative Target(s) Regulated by This miRNA Induced myeloid leukemia cell differentiation protein Mcl-1 (MCL1) Target Info
MCL1_HUMAN
miRNA Mature ID hsa-miR-876-3p miRNA Info
miRNA Mature AC
MIMAT0004925
Sequence uggugguuuacaaaguaauuca
miRNA Species Homo sapiens
Regulation Mechanism miR-876-3p reduced the expression of MCL1. [6]
Evidence Score (E-score) 1 +
1 Luciferase Reporter Assay; Western Blot [6]
Representative Target(s) Regulated by This miRNA Induced myeloid leukemia cell differentiation protein Mcl-1 (MCL1) Target Info
MCL1_HUMAN
References  Top
REF 1 Demethylation of miR-9-3 and miR-193a genes suppresses proliferation and promotes apoptosis in non-small cell lung cancer cell lines. Cell Physiol Biochem. 2013;32(6):1707-19.
REF 2 mir-29 regulates Mcl-1 protein expression and apoptosis. Oncogene. 2007 Sep 13;26(42):6133-40.
REF 3 Ionizing radiation-inducible microRNA miR-193a-3p induces apoptosis by directly targeting Mcl-1. Apoptosis. 2013 Jul;18(7):896-909.
REF 4 Gain-of-function microRNA screens identify miR-193a regulating proliferation and apoptosis in epithelial ovarian cancer cells. Int J Oncol. 2013 Jun;42(6):1875-82.
REF 5 Exploration of tumor-suppressive microRNAs silenced by DNA hypermethylation in oral cancer. Cancer Res. 2008 Apr 1;68(7):2094-105.
REF 6 A microRNA screen to identify modulators of sensitivity to BCL2 inhibitor ABT-263 (navitoclax). Mol Cancer Ther. 2010 Nov;9(11):2943-50.
REF 7 microRNAome changes in bystander three-dimensional human tissue models suggest priming of apoptotic pathways. Carcinogenesis. 2010 Oct;31(10):1882-8.
REF 8 Involvement of miRNAs in the differentiation of human glioblastoma multiforme stem-like cells. PLoS One. 2013 Oct 14;8(10):e77098.
REF 9 Effects of microRNA-29 on apoptosis, tumorigenicity, and prognosis of hepatocellular carcinoma. Hepatology. 2010 Mar;51(3):836-45.
REF 10 MicroRNA 29b functions in acute myeloid leukemia. Blood. 2009 Dec 17;114(26):5331-41.
REF 11 Identification of miRNomes in human stomach and gastric carcinoma reveals miR-133b/a-3p as therapeutic target for gastric cancer. Cancer Lett. 2015 Dec 1;369(1):58-66.
REF 12 The role of microRNA-133 in cardiac hypertrophy uncovered. Circ Res. 2010 Jan 8;106(1):16-8.
REF 13 MiR-133b is down-regulated in human osteosarcoma and inhibits osteosarcoma cells proliferation, migration and invasion, and promotes apoptosis. PLoS One. 2013 Dec 31;8(12):e83571.
REF 14 MicroRNA 133B targets pro-survival molecules MCL-1 and BCL2L2 in lung cancer. Biochem Biophys Res Commun. 2009 Oct 23;388(3):483-9.
REF 15 The tumor suppressor microRNA-29c is downregulated and restored by celecoxib in human gastric cancer cells. Int J Cancer. 2013 Apr 15;132(8):1751-60.
REF 16 miR-29b and miR-29c are involved in Toll-like receptor control of glucocorticoid-induced apoptosis in human plasmacytoid dendritic cells. PLoS One. 2013 Jul 23;8(7):e69926.
REF 17 miR-193b Modulates Resistance to Doxorubicin in Human Breast Cancer Cells by Downregulating MCL-1. Biomed Res Int. 2015;2015:373574.
REF 18 Restoration of miR-193b sensitizes Hepatitis B virus-associated hepatocellular carcinoma to sorafenib. Cancer Lett. 2014 Oct 1;352(2):245-52.
REF 19 Hepatitis C virus proteins modulate microRNA expression and chemosensitivity in malignant hepatocytes. Clin Cancer Res. 2010 Feb 1;16(3):957-66.
REF 20 Cutaneous manifestations in patients with POEMS syndrome. Int J Dermatol. 2013 Nov;52(11):1349-56.
REF 21 MiR-139 inhibits Mcl-1 expression and potentiates TMZ-induced apoptosis in glioma. CNS Neurosci Ther. 2013 Jul;19(7):477-83.
REF 22 MicroRNA-302b targets Mcl-1 and inhibits cell proliferation and induces apoptosis in malignant pleural mesothelioma cells. Am J Cancer Res. 2016 Sep 1;6(9):1996-2009.
REF 23 MicroRNA-302b Enhances the Sensitivity of Hepatocellular Carcinoma Cell Lines to 5-FU via Targeting Mcl-1 and DPYD. Int J Mol Sci. 2015 Oct 6;16(10):23668-82.
REF 24 miR-125a-5p inhibits cell proliferation and induces apoptosis in colon cancer via targeting BCL2, BCL2L12 and MCL1. Biomed Pharmacother. 2015 Oct;75:129-36.
REF 25 Decrease expression of microRNA-20a promotes cancer cell proliferation and predicts poor survival of hepatocellular carcinoma. J Exp Clin Cancer Res. 2013 Apr 18;32(1):21.
REF 26 miR-339-3p Is a Tumor Suppressor in Melanoma. Cancer Res. 2016 Jun 15;76(12):3562-71.
REF 27 miR-761 regulates the mitochondrial network by targeting mitochondrial fission factor. Free Radic Biol Med. 2013 Dec;65:371-379.

If You Find Any Error in Data or Bug in Web Service, Please Kindly Report It to Dr. Zhou and Dr. Zhang.