The microRNAs (miRNAs) Regulating This Target |
Top |
miRNA Mature ID |
hsa-miR-34a-5p |
miRNA Info
|
miRNA Mature AC |
|
Sequence |
uggcagugucuuagcugguugu
|
miRNA Species |
Homo sapiens |
Regulation Mechanism |
The overexpression of miR-34a-5p by mature miRNA precursor transfection resulted in the decreased protein level of target MAP2K1. |
[2] |
Evidence Score (E-score) |
2 |
+ |
1 |
qRT-PCR; Luciferase Reporter Assay; Western Blot; Northern Blot |
[1] |
2 |
qRT-PCR; Luciferase Reporter Assay; Western Blot; Northern Blot |
[2] |
Representative Target(s) Regulated by This miRNA |
Amphiregulin (AREG)
|
Target Info
|
|
Androgen receptor (AR)
|
Target Info
|
|
miRNA Mature ID |
hsa-miR-424-5p |
miRNA Info
|
miRNA Mature AC |
|
Sequence |
cagcagcaauucauguuuugaa
|
miRNA Species |
Homo sapiens |
Evidence Score (E-score) |
2 |
+ |
1 |
Immunohistochemistry; qRT-PCR; Western Blot |
[3] |
2 |
Immunohistochemistry; qRT-PCR; Western Blot |
[2] |
Representative Target(s) Regulated by This miRNA |
Checkpoint kinase-1 (CHK1)
|
Target Info
|
|
Cyclin D (CCND3)
|
Target Info
|
|
miRNA Mature ID |
hsa-miR-449a |
miRNA Info
|
miRNA Mature AC |
|
Sequence |
uggcaguguauuguuagcuggu
|
miRNA Species |
Homo sapiens |
Evidence Score (E-score) |
2 |
+ |
1 |
Luciferase Reporter Assay; qRT-PCR; Western Blot |
[4] |
2 |
qRT-PCR; Western Blot |
[5] |
Representative Target(s) Regulated by This miRNA |
Apoptosis regulator Bcl-2 (BCL-2)
|
Target Info
|
|
Cyclin-dependent kinase 4 (CDK4)
|
Target Info
|
|
miRNA Mature ID |
hsa-miR-204-5p |
miRNA Info
|
miRNA Mature AC |
|
Sequence |
uucccuuugucauccuaugccu
|
miRNA Species |
Homo sapiens |
Evidence Score (E-score) |
1 |
+ |
1 |
qRT-PCR; Western Blot |
[5] |
Representative Target(s) Regulated by This miRNA |
Alkaline phosphatase tissue-nonspecific (ALPL)
|
Target Info
|
|
Apoptosis regulator Bcl-2 (BCL-2)
|
Target Info
|
|
miRNA Mature ID |
hsa-miR-211-5p |
miRNA Info
|
miRNA Mature AC |
|
Sequence |
uucccuuugucauccuucgccu
|
miRNA Species |
Homo sapiens |
Evidence Score (E-score) |
1 |
+ |
1 |
qRT-PCR; Western Blot |
[5] |
Representative Target(s) Regulated by This miRNA |
Apoptosis regulator Bcl-2 (BCL-2)
|
Target Info
|
|
Calcium-activated potassium channel KCa1.1 (KCNMA1)
|
Target Info
|
|
miRNA Mature ID |
hsa-miR-34b-3p |
miRNA Info
|
miRNA Mature AC |
|
Sequence |
caaucacuaacuccacugccau
|
miRNA Species |
Homo sapiens |
Evidence Score (E-score) |
1 |
+ |
1 |
qRT-PCR; Western Blot |
[5] |
Representative Target(s) Regulated by This miRNA |
Apoptosis regulator Bcl-2 (BCL-2)
|
Target Info
|
|
Cyclic AMP-responsive element-binding protein (CREB1)
|
Target Info
|
|
miRNA Mature ID |
hsa-miR-34c-5p |
miRNA Info
|
miRNA Mature AC |
|
Sequence |
aggcaguguaguuagcugauugc
|
miRNA Species |
Homo sapiens |
Evidence Score (E-score) |
1 |
+ |
1 |
qRT-PCR; Western Blot |
[5] |
Representative Target(s) Regulated by This miRNA |
Apoptosis regulator Bcl-2 (BCL-2)
|
Target Info
|
|
Cyclin-dependent kinase 4 (CDK4)
|
Target Info
|
|
miRNA Mature ID |
hsa-miR-448 |
miRNA Info
|
miRNA Mature AC |
|
Sequence |
uugcauauguaggaugucccau
|
miRNA Species |
Homo sapiens |
Evidence Score (E-score) |
1 |
+ |
1 |
qRT-PCR; Western Blot |
[5] |
Representative Target(s) Regulated by This miRNA |
Apoptosis regulator Bcl-2 (BCL-2)
|
Target Info
|
|
ERK activator kinase 1 (MEK1)
|
Target Info
|
|
miRNA Mature ID |
hsa-miR-494-3p |
miRNA Info
|
miRNA Mature AC |
|
Sequence |
ugaaacauacacgggaaaccuc
|
miRNA Species |
Homo sapiens |
Evidence Score (E-score) |
1 |
+ |
1 |
qRT-PCR; Western Blot |
[5] |
Representative Target(s) Regulated by This miRNA |
Apoptosis inhibitor survivin (BIRC5)
|
Target Info
|
|
Apoptosis regulator Bcl-2 (BCL-2)
|
Target Info
|
|
miRNA Mature ID |
hsa-miR-497-5p |
miRNA Info
|
miRNA Mature AC |
|
Sequence |
cagcagcacacugugguuugu
|
miRNA Species |
Homo sapiens |
Regulation Mechanism |
miR-497 is a negative regulator of MEK1 protein expression through directly binding to the 3' UTR of the mRNA. |
[6] |
Evidence Score (E-score) |
1 |
+ |
1 |
Luciferase Reporter Assay; Western Blot |
[6] |
Representative Target(s) Regulated by This miRNA |
Angiomotin (AMOT)
|
Target Info
|
|
Apoptosis inhibitor survivin (BIRC5)
|
Target Info
|
|