Target Regulator(s) Information (MicroRNA)

Content Navigation (  All   None )                                      
Target General Information
The microRNAs (miRNAs) Regulating This Target
References
Target General Information  Top
Target ID T00494 Target Info
Target Name ATP-binding cassette transporter A1 (ABCA1)
Synonyms Cholesterol mobilizing transporter ABCA1; Cholesterol efflux regulatory protein; CERP; ATP-binding cassette transporter (ABCA1) transmembrane protein; ATP-binding cassette sub-family A member 1; ATP-binding cassette 1; ABC1; ABC-1
Target Type Successful Target
Gene Name ABCA1
Biochemical Class ABC transporter
UniProt ID
O95477
The microRNAs (miRNAs) Regulating This Target  Top
miRNA Mature ID hsa-miR-33a-5p miRNA Info
miRNA Mature AC
MIMAT0000091
Sequence gugcauuguaguugcauugca
miRNA Species Homo sapiens
Regulation Mechanism The overexpression of miR-33a-5p by mature miRNA precursor transfection resulted in the decreased protein level of target ABCA1. [3]
Evidence Score (E-score) 4 +
1 Luciferase Reporter Assay [1]
2 Luciferase Reporter Assay [2]
3 Luciferase Reporter Assay; Western Blot [3]
4 Western Blot [4]
Representative Target(s) Regulated by This miRNA ATP-binding cassette transporter A1 (ABCA1) Target Info
ABCA1_HUMAN
ATP-binding cassette transporter B11 (ABCB11) Target Info
ABCBB_HUMAN
miRNA Mature ID hsa-miR-26b-5p miRNA Info
miRNA Mature AC
MIMAT0000083
Sequence uucaaguaauucaggauaggu
miRNA Species Homo sapiens
Regulation Mechanism miR-26 suppressed ABCA1 via the binding sites located in their 3'UTR. [6]
Evidence Score (E-score) 2 +
1 Immunoblot; Luciferase Reporter Assay; qRT-PCR [5]
2 Microarray [6]
Representative Target(s) Regulated by This miRNA ATP-binding cassette transporter A1 (ABCA1) Target Info
ABCA1_HUMAN
Collagen I (COL1A2) Target Info
CO1A2_HUMAN
miRNA Mature ID hsa-miR-27a-3p miRNA Info
miRNA Mature AC
MIMAT0000084
Sequence uucacaguggcuaaguuccgc
miRNA Species Homo sapiens
Regulation Mechanism miR-27a affects the efflux, influx, esterification and hydrolysis of cellular cholesterol by regulating the expression of ABCA1. [8]
Evidence Score (E-score) 2 +
1 Luciferase Reporter Assay [7]
2 Luciferase Reporter Assay; Western Blot [8]
Representative Target(s) Regulated by This miRNA ATP-binding cassette transporter A1 (ABCA1) Target Info
ABCA1_HUMAN
Cellular tumor antigen p53 (TP53) Target Info
P53_HUMAN
miRNA Mature ID hsa-miR-27b-3p miRNA Info
miRNA Mature AC
MIMAT0000419
Sequence uucacaguggcuaaguucugc
miRNA Species Homo sapiens
Regulation Mechanism miR-27b affects the efflux, influx, esterification and hydrolysis of cellular cholesterol by regulating the expression of ABCA1. [8]
Evidence Score (E-score) 2 +
1 Luciferase Reporter Assay; qRT-PCR; Western Blot [9]
2 Luciferase Reporter Assay; Western Blot [8]
Representative Target(s) Regulated by This miRNA Adenosine A2b receptor (ADORA2B) Target Info
AA2BR_HUMAN
Albendazole monooxygenase (CYP3A4) Target Info
CP3A4_HUMAN
miRNA Mature ID hsa-miR-33a-3p miRNA Info
miRNA Mature AC
MIMAT0004506
Sequence caauguuuccacagugcaucac
miRNA Species Homo sapiens
Regulation Mechanism miR-33a targets gene ABCA1. [11]
Evidence Score (E-score) 2 +
1 ELISA; qRT-PCR [10]
2 qRT-PCR; Western Blot [11]
Representative Target(s) Regulated by This miRNA ATP-binding cassette transporter A1 (ABCA1) Target Info
ABCA1_HUMAN
miRNA Mature ID hsa-miR-17-5p miRNA Info
miRNA Mature AC
MIMAT0000070
Sequence caaagugcuuacagugcagguag
miRNA Species Homo sapiens
Regulation Mechanism miR-17 repressed ABCA1 expression through targeting the 3'UTR of ABCA1 and ABCA1 is a direct target of miR-17. [12]
Evidence Score (E-score) 1 +
1 ELISA; Luciferase Reporter Assay; Western Blot [12]
Representative Target(s) Regulated by This miRNA Amyloid beta A4 protein (APP) Target Info
A4_HUMAN
Apoptosis mediating surface antigen FAS (FAS) Target Info
TNR6_HUMAN
miRNA Mature ID hsa-miR-19a-3p miRNA Info
miRNA Mature AC
MIMAT0000073
Sequence ugugcaaaucuaugcaaaacuga
miRNA Species Homo sapiens
Regulation Mechanism ABCA1 is a Targets of miR-19a. [7]
Evidence Score (E-score) 1 +
1 Luciferase Reporter Assay [7]
Representative Target(s) Regulated by This miRNA Adrenergic receptor beta-1 (ADRB1) Target Info
ADRB1_HUMAN
Apoptosis signal-regulating kinase 1 (MAP3K5) Target Info
M3K5_HUMAN
miRNA Mature ID hsa-miR-302a-3p miRNA Info
miRNA Mature AC
MIMAT0000684
Sequence uaagugcuuccauguuuugguga
miRNA Species Homo sapiens
Evidence Score (E-score) 1 +
1 Luciferase Reporter Assay; Western Blot [13]
Representative Target(s) Regulated by This miRNA ATP-binding cassette transporter A1 (ABCA1) Target Info
ABCA1_HUMAN
Cyclin-dependent kinase 1 (CDK1) Target Info
CDK1_HUMAN
miRNA Mature ID hsa-miR-33b-5p miRNA Info
miRNA Mature AC
MIMAT0003301
Sequence gugcauugcuguugcauugc
miRNA Species Homo sapiens
Regulation Mechanism The overexpression of miR-33b-5p by mature miRNA precursor transfection resulted in the decreased protein level of target ABCA1. [3]
Evidence Score (E-score) 1 +
1 Luciferase Reporter Assay; Western Blot [3]
Representative Target(s) Regulated by This miRNA Apoptosis regulator Bcl-2 (BCL-2) Target Info
BCL2_HUMAN
ATP-binding cassette transporter A1 (ABCA1) Target Info
ABCA1_HUMAN
miRNA Mature ID hsa-miR-93-5p miRNA Info
miRNA Mature AC
MIMAT0000093
Sequence caaagugcuguucgugcagguag
miRNA Species Homo sapiens
Regulation Mechanism miR-93 repressed ABCA1 expression through targeting the 3'UTR of ABCA1 and ABCA1 is a direct target of miR-93. [12]
Evidence Score (E-score) 1 +
1 ELISA; Luciferase Reporter Assay; Western Blot [12]
Representative Target(s) Regulated by This miRNA Angiogenin (ANG) Target Info
ANGI_HUMAN
ATP-binding cassette transporter A1 (ABCA1) Target Info
ABCA1_HUMAN
miRNA Mature ID hsa-miR-148a-5p miRNA Info
miRNA Mature AC
MIMAT0004549
Sequence aaaguucugagacacuccgacu
miRNA Species Homo sapiens
Regulation Mechanism miR-148a directly targets the 3'UTR of ABCA1. [14]
Evidence Score (E-score) 1 +
1 Luciferase Reporter Assay; Northern Blot; Western Blot [14]
Representative Target(s) Regulated by This miRNA ATP-binding cassette transporter A1 (ABCA1) Target Info
ABCA1_HUMAN
CDK inhibitor 1B p27Kip1 (CDKN1B) Target Info
CDN1B_HUMAN
miRNA Mature ID hsa-miR-33b-3p miRNA Info
miRNA Mature AC
MIMAT0004811
Sequence cagugccucggcagugcagccc
miRNA Species Homo sapiens
Evidence Score (E-score) 1 +
1 qRT-PCR [15]
Representative Target(s) Regulated by This miRNA ATP-binding cassette transporter A1 (ABCA1) Target Info
ABCA1_HUMAN
High mobility group protein HMGI-C (HMGA2) Target Info
HMGA2_HUMAN
miRNA Mature ID hsa-miR-613 miRNA Info
miRNA Mature AC
MIMAT0003281
Sequence aggaauguuccuucuuugcc
miRNA Species Homo sapiens
Evidence Score (E-score) 1 +
1 Luciferase Reporter Assay; Western Blot [16]
Representative Target(s) Regulated by This miRNA ATP-binding cassette transporter A1 (ABCA1) Target Info
ABCA1_HUMAN
Brain-derived neurotrophic factor (BDNF) Target Info
BDNF_HUMAN
miRNA Mature ID hsa-miR-758-3p miRNA Info
miRNA Mature AC
MIMAT0003879
Sequence uuugugaccugguccacuaacc
miRNA Species Homo sapiens
Evidence Score (E-score) 1 +
1 Luciferase Reporter Assay [3]
Representative Target(s) Regulated by This miRNA ATP-binding cassette transporter A1 (ABCA1) Target Info
ABCA1_HUMAN
Toll-like receptor 3 (TLR3) Target Info
TLR3_HUMAN
References  Top
REF 1 miR-33 links SREBP-2 induction to repression of sterol transporters. Proc Natl Acad Sci U S A. 2010 Jul 6;107(27):12228-32.
REF 2 MiR-33 contributes to the regulation of cholesterol homeostasis. Science. 2010 Jun 18;328(5985):1570-3.
REF 3 MicroRNA-33 and the SREBP host genes cooperate to control cholesterol homeostasis. Science. 2010 Jun 18;328(5985):1566-9.
REF 4 miR-33a expression sensitizes Lgr5+ HCC-CSCs to doxorubicin via ABCA1. Neoplasma. 2017;64(1):81-91.
REF 5 MiR-26 controls LXR-dependent cholesterol efflux by targeting ABCA1 and ARL7. FEBS Lett. 2012 May 21;586(10):1472-9.
REF 6 MicroRNA target prediction by expression analysis of host genes. Genome Res. 2009 Mar;19(3):481-90.
REF 7 Identification of novel AR-targeted microRNAs mediating androgen signalling through critical pathways to regulate cell viability in prostate cancer. PLoS One. 2013;8(2):e56592.
REF 8 MicroRNA-27a/b regulates cellular cholesterol efflux, influx and esterification/hydrolysis in THP-1 macrophages. Atherosclerosis. 2014 May;234(1):54-64.
REF 9 miR-27b inhibits LDLR and ABCA1 expression but does not influence plasma and hepatic lipid levels in mice. Atherosclerosis. 2015 Dec;243(2):499-509.
REF 10 Aberrant expression of plasma microRNA-33a in an atherosclerosis-risk group. Mol Biol Rep. 2017 Feb;44(1):79-88.
REF 11 Hepatic miR-33a/miR-144 and their target gene ABCA1 are associated with steatohepatitis in morbidly obese subjects. Liver Int. 2016 Sep;36(9):1383-91.
REF 12 Up-regulated miR-93 contributes to coronary atherosclerosis pathogenesis through targeting ABCA1. Int J Clin Exp Med. 2015 Jan 15;8(1):674-81.
REF 13 MicroRNA 302a is a novel modulator of cholesterol homeostasis and atherosclerosis. Arterioscler Thromb Vasc Biol. 2015 Feb;35(2):323-31.
REF 14 MicroRNA-148a regulates LDL receptor and ABCA1 expression to control circulating lipoprotein levels. Nat Med. 2015 Nov;21(11):1280-9.
REF 15 Clinical Significance of Determining Plasma MicroRNA33b in Type 2 Diabetic Patients with Dyslipidemia. J Atheroscler Thromb. 2016 Nov 1;23(11):1276-1285.
REF 16 miR-613 regulates cholesterol efflux by targeting LXR and ABCA1 in PPAR activated THP-1 macrophages. Biochem Biophys Res Commun. 2014 Jun 6;448(3):329-34.

If You Find Any Error in Data or Bug in Web Service, Please Kindly Report It to Dr. Zhou and Dr. Zhang.