Target Regulator(s) Information (MicroRNA)

Content Navigation (  All   None )                                      
Target General Information
The microRNAs (miRNAs) Regulating This Target
References
Target General Information  Top
Target ID T61544 Target Info
Target Name Transcription factor Sp1 (SP1)
Synonyms TSFP1
Target Type Clinical trial Target
Gene Name SP1
UniProt ID
P08047
The microRNAs (miRNAs) Regulating This Target  Top
miRNA Mature ID hsa-miR-22-3p miRNA Info
miRNA Mature AC
MIMAT0000077
Sequence aagcugccaguugaagaacugu
miRNA Species Homo sapiens
Regulation Mechanism miR-22 exerts inhibitory effects on Sp1 expression via interaction with the 3'UTR of Sp1. [3]
Evidence Score (E-score) 3 +
1 Luciferase Reporter Assay [1]
2 Luciferase Reporter Assay; qRT-PCR; Western Blot [2]
3 Reporter Assay [3]
Representative Target(s) Regulated by This miRNA 5-HT 2C receptor (HTR2C) Target Info
5HT2C_HUMAN
ATP-citrate synthase (ACLY) Target Info
ACLY_HUMAN
miRNA Mature ID hsa-miR-27a-3p miRNA Info
miRNA Mature AC
MIMAT0000084
Sequence uucacaguggcuaaguuccgc
miRNA Species Homo sapiens
Evidence Score (E-score) 3 +
1 Luciferase Reporter Assay; Western Blot [4]
2 Western Blot [5]
3 Western Blot; qRT-PCR [6]
Representative Target(s) Regulated by This miRNA ATP-binding cassette transporter A1 (ABCA1) Target Info
ABCA1_HUMAN
Cellular tumor antigen p53 (TP53) Target Info
P53_HUMAN
miRNA Mature ID hsa-miR-145-5p miRNA Info
miRNA Mature AC
MIMAT0000437
Sequence guccaguuuucccaggaaucccu
miRNA Species Homo sapiens
Regulation Mechanism Introducing miR-145 into SKOV3/PTX and A2780/PTX cells led to a reduction in Cdk6 and Sp1 along with downregulation of P-gp and pRb. [8]
Evidence Score (E-score) 2 +
1 Immunofluorescence; Luciferase Reporter Assay; Western Blot [7]
2 Immunohistochemistry; Luciferase Reporter Assay; Western Blot [8]
Representative Target(s) Regulated by This miRNA A proliferation-inducing ligand (APRIL) Target Info
TNF13_HUMAN
Alkaline phosphatase (ALPPL2) Target Info
PPBN_HUMAN
miRNA Mature ID hsa-miR-149-5p miRNA Info
miRNA Mature AC
MIMAT0000450
Sequence ucuggcuccgugucuucacuccc
miRNA Species Homo sapiens
Regulation Mechanism SP1 is identified as a target of miR-149 in CRC. [10]
Evidence Score (E-score) 2 +
1 Luciferase Reporter Assay [9]
2 Luciferase Reporter Assay [10]
Representative Target(s) Regulated by This miRNA Apoptosis antigen ligand (CD178) Target Info
TNFL6_HUMAN
Bcl-2-binding component 3 (BBC3) Target Info
BBC3_HUMAN
miRNA Mature ID hsa-miR-150-5p miRNA Info
miRNA Mature AC
MIMAT0000451
Sequence ucucccaacccuuguaccagug
miRNA Species Homo sapiens
Regulation Mechanism Sp1 is the target of miR-150. [11]
Evidence Score (E-score) 2 +
1 Luciferase Reporter Assay [11]
2 Luciferase Reporter Assay; qRT-PCR; Western Blot [12]
Representative Target(s) Regulated by This miRNA Apoptosis inhibitor survivin (BIRC5) Target Info
BIRC5_HUMAN
Beta-arrestin-2 (ARRB2) Target Info
ARRB2_HUMAN
miRNA Mature ID hsa-miR-200b-3p miRNA Info
miRNA Mature AC
MIMAT0000318
Sequence uaauacugccugguaaugauga
miRNA Species Homo sapiens
Regulation Mechanism Ectopic expression of miR-200b in gastric cancer cells impaired proliferation and invasion through direct targeting of DNMT3A expression indirectly via down-regulation of SP1. [13]
Evidence Score (E-score) 2 +
1 In Situ Hybridization; Luciferase Reporter Assay; Western Blot [13]
2 Luciferase Reporter Assay; qRT-PCR; Western Blot [14]
Representative Target(s) Regulated by This miRNA Apoptosis regulator Bcl-2 (BCL-2) Target Info
BCL2_HUMAN
CDK inhibitor 1B p27Kip1 (CDKN1B) Target Info
CDN1B_HUMAN
miRNA Mature ID hsa-miR-29c-3p miRNA Info
miRNA Mature AC
MIMAT0000681
Sequence uagcaccauuugaaaucgguua
miRNA Species Homo sapiens
Regulation Mechanism miR-29c directly bound to Sp1 DNA. [16]
Evidence Score (E-score) 2 +
1 Luciferase Reporter Assay; qRT-PCR; Western Blot [15]
2 Luciferase Reporter Assay; Western Blot [16]
Representative Target(s) Regulated by This miRNA Apoptosis regulator Bcl-2 (BCL-2) Target Info
BCL2_HUMAN
B7 homolog 3 (CD276) Target Info
CD276_HUMAN
miRNA Mature ID hsa-miR-133b miRNA Info
miRNA Mature AC
MIMAT0000770
Sequence uuugguccccuucaaccagcua
miRNA Species Homo sapiens
Regulation Mechanism miR-133b suppressed the proliferation, migration, invasion and cell cycle progression of gastric cancer cells through decreasing expression of Sp1 and its downstream proteins. [7]
Evidence Score (E-score) 1 +
1 Luciferase Reporter Assay; Western Blot [7]
Representative Target(s) Regulated by This miRNA Apoptosis mediating surface antigen FAS (FAS) Target Info
TNR6_HUMAN
Apoptosis regulator Bcl-W (BCL-W) Target Info
B2CL2_HUMAN
miRNA Mature ID hsa-miR-200c-3p miRNA Info
miRNA Mature AC
MIMAT0000617
Sequence uaauacugccggguaaugaugga
miRNA Species Homo sapiens
Regulation Mechanism Ectopic expression of miR-200c in gastric cancer cells impaired proliferation and invasion through direct targeting of DNMT3A expression indirectly via down-regulation of SP1. [13]
Evidence Score (E-score) 1 +
1 In Situ Hybridization; Luciferase Reporter Assay; Western Blot [13]
Representative Target(s) Regulated by This miRNA Activin receptor type IIB (ACVR2B) Target Info
AVR2B_HUMAN
Apoptosis regulator Bcl-2 (BCL-2) Target Info
BCL2_HUMAN
miRNA Mature ID hsa-miR-21-5p miRNA Info
miRNA Mature AC
MIMAT0000076
Sequence uagcuuaucagacugauguuga
miRNA Species Homo sapiens
Regulation Mechanism miR-21 repressed SP1 protein expression by directly targeting at SP1 3'untranslational regions. [17]
Evidence Score (E-score) 1 +
1 Luciferase Reporter Assay; Western Blot [17]
Representative Target(s) Regulated by This miRNA Apoptosis antigen ligand (CD178) Target Info
TNFL6_HUMAN
Apoptosis regulator Bcl-2 (BCL-2) Target Info
BCL2_HUMAN
miRNA Mature ID hsa-miR-223-3p miRNA Info
miRNA Mature AC
MIMAT0000280
Sequence ugucaguuugucaaauacccca
miRNA Species Homo sapiens
Evidence Score (E-score) 1 +
1 Luciferase Reporter Assay [18]
Representative Target(s) Regulated by This miRNA ATM serine/threonine kinase (ATM) Target Info
ATM_HUMAN
C-X-C motif chemokine 2 (CXCL2) Target Info
CXCL2_HUMAN
miRNA Mature ID hsa-miR-29b-3p miRNA Info
miRNA Mature AC
MIMAT0000100
Sequence uagcaccauuugaaaucaguguu
miRNA Species Homo sapiens
Regulation Mechanism The overexpression of miR-29b-3p by mature miRNA precursor transfection resulted in the decreased protein level of target SP1. [5]
Evidence Score (E-score) 1 +
1 qRT-PCR; Luciferase Reporter Assay [5]
Representative Target(s) Regulated by This miRNA Beta-secretase 1 (BACE1) Target Info
BACE1_HUMAN
Cyclin-dependent kinase 6 (CDK6) Target Info
CDK6_HUMAN
miRNA Mature ID hsa-miR-324-5p miRNA Info
miRNA Mature AC
MIMAT0000761
Sequence cgcauccccuagggcauuggug
miRNA Species Homo sapiens
Regulation Mechanism miR-324-5p regulates SP1 by binding its 3'UTR. [19]
Evidence Score (E-score) 1 +
1 ELISA; Luciferase Reporter Assay; Western Blot [19]
Representative Target(s) Regulated by This miRNA Programmed cell death 1 ligand 1 (PD-L1) Target Info
PD1L1_HUMAN
Protein C-ets-1 (ETS1) Target Info
ETS1_HUMAN
miRNA Mature ID hsa-miR-326 miRNA Info
miRNA Mature AC
MIMAT0000756
Sequence ccucugggcccuuccuccag
miRNA Species Homo sapiens
Regulation Mechanism miR-326 directly targets SP1. And miR-326 mimics led to the attenuation of fluorescence of the wt-3'TR, but had no effect on the mutant of SP1 3'TR. [20]
Evidence Score (E-score) 1 +
1 Luciferase Reporter Assay; Western Blot [20]
Representative Target(s) Regulated by This miRNA Apoptosis regulator Bcl-xL (BCL-xL) Target Info
B2CL1_HUMAN
Fascin (FSCN1) Target Info
FSCN1_HUMAN
miRNA Mature ID hsa-miR-330-3p miRNA Info
miRNA Mature AC
MIMAT0000751
Sequence gcaaagcacacggccugcagaga
miRNA Species Homo sapiens
Regulation Mechanism miR-330 inhibited Sp1 expression through direct binding of the 3'UTR of its transcript. [21]
Evidence Score (E-score) 1 +
1 Luciferase Reporter Assay [21]
Representative Target(s) Regulated by This miRNA E2F transcription factor 1 (E2F1) Target Info
E2F1_HUMAN
Extracellular matrix receptor III (CD44) Target Info
CD44_HUMAN
miRNA Mature ID hsa-miR-335-5p miRNA Info
miRNA Mature AC
MIMAT0000765
Sequence ucaagagcaauaacgaaaaaugu
miRNA Species Homo sapiens
Evidence Score (E-score) 1 +
1 Reporter Assay; Western Blot [22]
Representative Target(s) Regulated by This miRNA Apoptosis inhibitor survivin (BIRC5) Target Info
BIRC5_HUMAN
Apoptosis regulator Bcl-W (BCL-W) Target Info
B2CL2_HUMAN
miRNA Mature ID hsa-miR-33a-5p miRNA Info
miRNA Mature AC
MIMAT0000091
Sequence gugcauuguaguugcauugca
miRNA Species Homo sapiens
Evidence Score (E-score) 1 +
1 Luciferase Reporter Assay; Western Blot [23]
Representative Target(s) Regulated by This miRNA ATP-binding cassette transporter A1 (ABCA1) Target Info
ABCA1_HUMAN
ATP-binding cassette transporter B11 (ABCB11) Target Info
ABCBB_HUMAN
miRNA Mature ID hsa-miR-429 miRNA Info
miRNA Mature AC
MIMAT0001536
Sequence uaauacugucugguaaaaccgu
miRNA Species Homo sapiens
Regulation Mechanism miR-429 overexpression downregulated Sp1 protein expression. [24]
Evidence Score (E-score) 1 +
1 Luciferase Reporter Assay; Western Blot [24]
Representative Target(s) Regulated by This miRNA Apoptosis regulator Bcl-2 (BCL-2) Target Info
BCL2_HUMAN
DNA [cytosine-5]-methyltransferase 1 (DNMT1) Target Info
DNMT1_HUMAN
miRNA Mature ID hsa-miR-892b miRNA Info
miRNA Mature AC
MIMAT0004918
Sequence cacuggcuccuuucuggguaga
miRNA Species Homo sapiens
Regulation Mechanism miR-892b could reduce activity of the Sp-1. [25]
Evidence Score (E-score) 1 +
1 EMSA [25]
Representative Target(s) Regulated by This miRNA Cyclin-dependent kinase 2 (CDK2) Target Info
CDK2_HUMAN
Cyclin-dependent kinase 6 (CDK6) Target Info
CDK6_HUMAN
miRNA Mature ID hsa-miR-218-5p miRNA Info
miRNA Mature AC
MIMAT0000275
Sequence uugugcuugaucuaaccaugu
miRNA Species Homo sapiens
Regulation Mechanism The overexpression of miR-218-5p by mature miRNA precursor transfection resulted in the decreased protein level of target SP1. [5]
Evidence Score (E-score) 1 +
1 Western Blot; qRT-PCR; Luciferase Reporter Assay [5]
Representative Target(s) Regulated by This miRNA Laminin beta-3 chain (LAMB3) Target Info
LAMB3_HUMAN
Transcription factor Sp1 (SP1) Target Info
SP1_HUMAN
miRNA Mature ID hsa-miR-612 miRNA Info
miRNA Mature AC
MIMAT0003280
Sequence gcugggcagggcuucugagcuccuu
miRNA Species Homo sapiens
Evidence Score (E-score) 1 +
1 Luciferase Reporter Assay; Western Blot [26]
Representative Target(s) Regulated by This miRNA Cellular tumor antigen p53 (TP53) Target Info
P53_HUMAN
RAC-beta serine/threonine-protein kinase (AKT2) Target Info
AKT2_HUMAN
miRNA Mature ID hsa-miR-711 miRNA Info
miRNA Mature AC
MIMAT0012734
Sequence gggacccagggagagacguaag
miRNA Species Homo sapiens
Evidence Score (E-score) 1 +
1 Luciferase Reporter Assay; Western Blot [27]
Representative Target(s) Regulated by This miRNA Cyclin-dependent kinase 4 (CDK4) Target Info
CDK4_HUMAN
Transcription factor Sp1 (SP1) Target Info
SP1_HUMAN
References  Top
REF 1 miR-22 is down-regulated in gastric cancer, and its overexpression inhibits cell migration and invasion via targeting transcription factor Sp1. Med Oncol. 2013 Jun;30(2):542.
REF 2 Berberine upregulates miR-22-3p to suppress hepatocellular carcinoma cell proliferation by targeting Sp1. Am J Transl Res. 2016 Nov 15;8(11):4932-4941.
REF 3 miR-22 represses cancer progression by inducing cellular senescence. J Cell Biol. 2011 Apr 18;193(2):409-24.
REF 4 A feedback loop consisting of microRNA 23a/27a and the -like globin suppressors KLF3 and SP1 regulates globin gene expression. Mol Cell Biol. 2013 Oct;33(20):3994-4007.
REF 5 The oncogenic microRNA-27a targets genes that regulate specificity protein transcription factors and the G2-M checkpoint in MDA-MB-231 breast cancer cells. Cancer Res. 2007 Nov 15;67(22):11001-11.
REF 6 MicroRNA-27a Indirectly Regulates Estrogen Receptor {alpha} Expression and Hormone Responsiveness in MCF-7 Breast Cancer Cells. Endocrinology. 2010 Jun;151(6):2462-73.
REF 7 MiR-145, miR-133a and miR-133b inhibit proliferation, migration, invasion and cell cycle progression via targeting transcription factor Sp1 in gastric cancer. FEBS Lett. 2014 Apr 2;588(7):1168-77.
REF 8 miR-145 sensitizes ovarian cancer cells to paclitaxel by targeting Sp1 and Cdk6. Int J Cancer. 2014 Sep 15;135(6):1286-96.
REF 9 SP1 mediates the link between methylation of the tumour suppressor miR-149 and outcome in colorectal cancer. J Pathol. 2013 Jan;229(1):12-24.
REF 10 miR-615-5p is restrictedly expressed in cirrhotic and cancerous liver tissues and its overexpression alleviates the tumorigenic effects in hepatocellular carcinoma. FEBS Lett. 2012 Sep 21;586(19):3309-16.
REF 11 Activation of hepatic stellate cells is suppressed by microRNA-150. Int J Mol Med. 2013 Jul;32(1):17-24.
REF 12 Long non-coding RNA ZFAS1 interacts with miR-150-5p to regulate Sp1 expression and ovarian cancer cell malignancy. Oncotarget. 2017 Mar 21;8(12):19534-19546.
REF 13 miR-200b and miR-200c as prognostic factors and mediators of gastric cancer cell progression. Clin Cancer Res. 2013 Oct 15;19(20):5602-12.
REF 14 MiR-200b expression in breast cancer: a prognostic marker and act on cell proliferation and apoptosis by targeting Sp1. J Cell Mol Med. 2015 Apr;19(4):760-9.
REF 15 A regulatory loop involving miR-29c and Sp1 elevates the TGF-1 mediated epithelial-to-mesenchymal transition in lung cancer. Oncotarget. 2016 Dec 27;7(52):85905-85916.
REF 16 miR-29c contribute to glioma cells temozolomide sensitivity by targeting O6-methylguanine-DNA methyltransferases indirectely. Oncotarget. 2016 Aug 2;7(31):50229-50238.
REF 17 MicroRNA-21 represses human cystathionine gamma-lyase expression by targeting at specificity protein-1 in smooth muscle cells. J Cell Physiol. 2012 Sep;227(9):3192-200.
REF 18 Decoy oligonucleotide rescues IGF1R expression from MicroRNA-223 suppression. PLoS One. 2013 Dec 4;8(12):e82167.
REF 19 MiR-324-5p Suppresses Hepatocellular Carcinoma Cell Invasion by Counteracting ECM Degradation through Post-Transcriptionally Downregulating ETS1 and SP1. PLoS One. 2015 Jul 15;10(7):e0133074.
REF 20 miR-326 reverses chemoresistance in human lung adenocarcinoma cells by targeting specificity protein 1. Tumour Biol. 2016 Oct;37(10):13287-13294.
REF 21 microRNA-330 inhibits cell motility by downregulating Sp1 in prostate cancer cells. Oncol Rep. 2013 Jul;30(1):327-33.
REF 22 MicroRNA miR-335 is crucial for the BRCA1 regulatory cascade in breast cancer development. Int J Cancer. 2011 Dec 15;129(12):2797-806.
REF 23 Effect of miR-335 upregulation on the apoptosis and invasion of lung cancer cell A549 and H1299. Tumour Biol. 2013 Oct;34(5):3101-9.
REF 24 Tumor-suppressing effects of microRNA-429 in human renal cell carcinoma via the downregulation of Sp1. Oncol Lett. 2016 Oct;12(4):2906-2911.
REF 25 MicroRNA-892b influences proliferation, migration and invasion of bladder cancer cells by mediating the p19ARF/cyclin D1/CDK6 and Sp-1/MMP-9 pathways. Oncol Rep. 2016 Oct;36(4):2313-20.
REF 26 miR-612 suppresses stem cell-like property of hepatocellular carcinoma cells by modulating Sp1/Nanog signaling. Cell Death Dis. 2016 Sep 29;7(9):e2377.
REF 27 MiRNA-711-SP1-collagen-I pathway is involved in the anti-fibrotic effect of pioglitazone in myocardial infarction. Sci China Life Sci. 2013 May;56(5):431-9.

If You Find Any Error in Data or Bug in Web Service, Please Kindly Report It to Dr. Zhou and Dr. Zhang.