Target Regulator(s) Information (MicroRNA)

Content Navigation (  All   None )                                      
Target General Information
The microRNAs (miRNAs) Regulating This Target
References
Target General Information  Top
Target ID T72507 Target Info
Target Name Cyclin D (CCND3)
Synonyms G1/S-specific cyclin-D3
Target Type Literature-reported Target
Gene Name CCND3
UniProt ID
P30281
The microRNAs (miRNAs) Regulating This Target  Top
miRNA Mature ID hsa-miR-15b-5p miRNA Info
miRNA Mature AC
MIMAT0000417
Sequence uagcagcacaucaugguuuaca
miRNA Species Homo sapiens
Evidence Score (E-score) 2 +
1 Luciferase Reporter Assay; Microarray; qRT-PCR; Western Blot [1]
2 Luciferase Reporter Assay; Microarray; qRT-PCR; Western Blot [2]
Representative Target(s) Regulated by This miRNA Apoptosis regulator Bcl-2 (BCL-2) Target Info
BCL2_HUMAN
Checkpoint kinase-1 (CHK1) Target Info
CHK1_HUMAN
miRNA Mature ID hsa-miR-195-5p miRNA Info
miRNA Mature AC
MIMAT0000461
Sequence uagcagcacagaaauauuggc
miRNA Species Homo sapiens
Regulation Mechanism CCND3 was a Functional Targetsof miR-195 in Glioblastoma Cells. [4]
Evidence Score (E-score) 2 +
1 Luciferase Reporter Assay; Western Blot [3]
2 Luciferase Reporter Assay; Western Blot [4]
Representative Target(s) Regulated by This miRNA ADP-ribosylation factor-like protein 2 (ARL2) Target Info
ARL2_HUMAN
Apoptosis inhibitor survivin (BIRC5) Target Info
BIRC5_HUMAN
miRNA Mature ID hsa-miR-15b-3p miRNA Info
miRNA Mature AC
MIMAT0004586
Sequence cgaaucauuauuugcugcucua
miRNA Species Homo sapiens
Evidence Score (E-score) 2 +
1 Western Blot [5]
2 Western Blot [1]
Representative Target(s) Regulated by This miRNA Cyclin D (CCND3) Target Info
CCND3_HUMAN
Insulin-like growth factor I receptor (IGF1R) Target Info
IGF1R_HUMAN
miRNA Mature ID hsa-miR-16-5p miRNA Info
miRNA Mature AC
MIMAT0000069
Sequence uagcagcacguaaauauuggcg
miRNA Species Homo sapiens
Regulation Mechanism The overexpression of miR-16-5p resulted in the decreased protein level of target CCND3. [2]
Evidence Score (E-score) 1 +
1 Western Blot; Luciferase Reporter Assay [2]
Representative Target(s) Regulated by This miRNA Apoptosis regulator Bcl-2 (BCL-2) Target Info
BCL2_HUMAN
Corticotropin-releasing factor binding protein (CRHBP) Target Info
CRHBP_HUMAN
miRNA Mature ID hsa-miR-34a-5p miRNA Info
miRNA Mature AC
MIMAT0000255
Sequence uggcagugucuuagcugguugu
miRNA Species Homo sapiens
Evidence Score (E-score) 1 +
1 Western Blot [2]
Representative Target(s) Regulated by This miRNA Amphiregulin (AREG) Target Info
AREG_HUMAN
Androgen receptor (AR) Target Info
ANDR_HUMAN
miRNA Mature ID hsa-miR-424-5p miRNA Info
miRNA Mature AC
MIMAT0001341
Sequence cagcagcaauucauguuuugaa
miRNA Species Homo sapiens
Evidence Score (E-score) 1 +
1 Luciferase Reporter Assay; Western Blot [6]
Representative Target(s) Regulated by This miRNA Checkpoint kinase-1 (CHK1) Target Info
CHK1_HUMAN
Cyclin D (CCND3) Target Info
CCND3_HUMAN
miRNA Mature ID hsa-miR-497-5p miRNA Info
miRNA Mature AC
MIMAT0002820
Sequence cagcagcacacugugguuugu
miRNA Species Homo sapiens
Regulation Mechanism CCND3 is a novel direct target of miR-497 in HCC cells. [3]
Evidence Score (E-score) 1 +
1 Luciferase Reporter Assay; Western Blot [3]
Representative Target(s) Regulated by This miRNA Angiomotin (AMOT) Target Info
AMOT_HUMAN
Apoptosis inhibitor survivin (BIRC5) Target Info
BIRC5_HUMAN
miRNA Mature ID hsa-miR-503-5p miRNA Info
miRNA Mature AC
MIMAT0002874
Sequence uagcagcgggaacaguucugcag
miRNA Species Homo sapiens
Evidence Score (E-score) 1 +
1 Western Blot [7]
Representative Target(s) Regulated by This miRNA Apoptosis regulator Bcl-2 (BCL-2) Target Info
BCL2_HUMAN
CD40L receptor (CD40) Target Info
TNR5_HUMAN
References  Top
REF 1 Activation of TLR7 increases CCND3 expression via the downregulation of miR-15b in B cells of systemic lupus erythematosus. Cell Mol Immunol. 2016 Nov;13(6):764-775.
REF 2 Downregulation of CCND1 and CDK6 by miR-34a induces cell cycle arrest. FEBS Lett. 2008 Apr 30;582(10):1564-8.
REF 3 The tumor-suppressive miR-497-195 cluster targets multiple cell-cycle regulators in hepatocellular carcinoma. PLoS One. 2013;8(3):e60155.
REF 4 MicroRNA-195 plays a tumor-suppressor role in human glioblastoma cells by targeting signaling pathways involved in cellular proliferation and invasion. Neuro Oncol. 2012 Mar;14(3):278-87.
REF 5 Up-regulation of microRNA-15b correlates with unfavorable prognosis and malignant progression of human glioma. Int J Clin Exp Pathol. 2015 May 1;8(5):4943-52.
REF 6 miR-16 family induces cell cycle arrest by regulating multiple cell cycle genes. Nucleic Acids Res. 2008 Sep;36(16):5391-404.
REF 7 MicroRNA-503 inhibits the G1/S transition by downregulating cyclin D3 and E2F3 in hepatocellular carcinoma. J Transl Med. 2013 Aug 22;11:195.

If You Find Any Error in Data or Bug in Web Service, Please Kindly Report It to Dr. Zhou and Dr. Zhang.