The microRNAs (miRNAs) Regulating This Target |
Top |
miRNA Mature ID |
hsa-miR-126-3p |
miRNA Info
|
miRNA Mature AC |
|
Sequence |
ucguaccgugaguaauaaugcg
|
miRNA Species |
Homo sapiens |
Regulation Mechanism |
CXCR4 is indeed the target gene of miR-126. |
[2] |
Evidence Score (E-score) |
3 |
+ |
1 |
Luciferase Reporter Assay |
[1] |
2 |
Luciferase Reporter Assay; Western Blot |
[2] |
3 |
qRT-PCR; Western Blot |
[3] |
Representative Target(s) Regulated by This miRNA |
Adrenomedullin (ADM)
|
Target Info
|
|
Angiopoietin 1 receptor (TEK)
|
Target Info
|
|
miRNA Mature ID |
hsa-miR-139-5p |
miRNA Info
|
miRNA Mature AC |
|
Sequence |
ucuacagugcacgugucuccagu
|
miRNA Species |
Homo sapiens |
Evidence Score (E-score) |
2 |
+ |
1 |
Luciferase Reporter Assay; Northern Blot; Western Blot |
[4] |
2 |
Luciferase Reporter Assay; qRT-PCR; Western Blot |
[5] |
Representative Target(s) Regulated by This miRNA |
Apoptosis regulator Bcl-2 (BCL-2)
|
Target Info
|
|
C-X-C chemokine receptor type 4 (CXCR4)
|
Target Info
|
|
miRNA Mature ID |
hsa-miR-146a-5p |
miRNA Info
|
miRNA Mature AC |
|
Sequence |
ugagaacugaauuccauggguu
|
miRNA Species |
Homo sapiens |
Evidence Score (E-score) |
2 |
+ |
1 |
Luciferase Reporter Assay; qRT-PCR; Western Blot |
[6] |
2 |
Luciferase Reporter Assay; qRT-PCR; Western Blot |
[7] |
Representative Target(s) Regulated by This miRNA |
Activation B7-1 antigen (CD80)
|
Target Info
|
|
Apoptosis mediating surface antigen FAS (FAS)
|
Target Info
|
|
miRNA Mature ID |
hsa-miR-622 |
miRNA Info
|
miRNA Mature AC |
|
Sequence |
acagucugcugagguuggagc
|
miRNA Species |
Homo sapiens |
Regulation Mechanism |
miR-622 regulats the expression of CXCR4 in AML cell lines. |
[6] |
Evidence Score (E-score) |
2 |
+ |
1 |
Luciferase Reporter Assay; qRT-PCR; Western Blot |
[8] |
2 |
Luciferase Reporter Assay; Western Blot |
[6] |
Representative Target(s) Regulated by This miRNA |
C-X-C chemokine receptor type 4 (CXCR4)
|
Target Info
|
|
Laminin gamma-2 subunit (LAMC2)
|
Target Info
|
|
miRNA Mature ID |
hsa-miR-133b |
miRNA Info
|
miRNA Mature AC |
|
Sequence |
uuugguccccuucaaccagcua
|
miRNA Species |
Homo sapiens |
Regulation Mechanism |
miR-133b regulated CXCR4 by targeting CXCR4 3'UTR. |
[9] |
Evidence Score (E-score) |
1 |
+ |
1 |
Luciferase Reporter Assay; Western Blot |
[9] |
Representative Target(s) Regulated by This miRNA |
Apoptosis mediating surface antigen FAS (FAS)
|
Target Info
|
|
Apoptosis regulator Bcl-W (BCL-W)
|
Target Info
|
|
miRNA Mature ID |
hsa-miR-150-5p |
miRNA Info
|
miRNA Mature AC |
|
Sequence |
ucucccaacccuuguaccagug
|
miRNA Species |
Homo sapiens |
Evidence Score (E-score) |
1 |
+ |
1 |
Western Blot |
[10] |
Representative Target(s) Regulated by This miRNA |
Apoptosis inhibitor survivin (BIRC5)
|
Target Info
|
|
Beta-arrestin-2 (ARRB2)
|
Target Info
|
|
miRNA Mature ID |
hsa-miR-204-5p |
miRNA Info
|
miRNA Mature AC |
|
Sequence |
uucccuuugucauccuaugccu
|
miRNA Species |
Homo sapiens |
Regulation Mechanism |
CXCR4 is a direct target of miR-204-5p in OSCC cells. |
[11] |
Evidence Score (E-score) |
1 |
+ |
1 |
Luciferase Reporter Assay; Western Blot |
[11] |
Representative Target(s) Regulated by This miRNA |
Alkaline phosphatase tissue-nonspecific (ALPL)
|
Target Info
|
|
Apoptosis regulator Bcl-2 (BCL-2)
|
Target Info
|
|
miRNA Mature ID |
hsa-miR-224-5p |
miRNA Info
|
miRNA Mature AC |
|
Sequence |
ucaagucacuagugguuccguuuag
|
miRNA Species |
Homo sapiens |
Evidence Score (E-score) |
1 |
+ |
1 |
Luciferase Reporter Assay; Western Blot |
[12] |
Representative Target(s) Regulated by This miRNA |
APJ endogenous ligand (Apelin)
|
Target Info
|
|
Apoptosis regulator Bcl-2 (BCL-2)
|
Target Info
|
|
miRNA Mature ID |
hsa-miR-335-5p |
miRNA Info
|
miRNA Mature AC |
|
Sequence |
ucaagagcaauaacgaaaaaugu
|
miRNA Species |
Homo sapiens |
Regulation Mechanism |
miR-335 regulats the expression of CXCR4 in AML cell lines. |
[6] |
Evidence Score (E-score) |
1 |
+ |
1 |
Luciferase Reporter Assay; Western Blot |
[6] |
Representative Target(s) Regulated by This miRNA |
Apoptosis inhibitor survivin (BIRC5)
|
Target Info
|
|
Apoptosis regulator Bcl-W (BCL-W)
|
Target Info
|
|
miRNA Mature ID |
hsa-miR-494-3p |
miRNA Info
|
miRNA Mature AC |
|
Sequence |
ugaaacauacacgggaaaccuc
|
miRNA Species |
Homo sapiens |
Evidence Score (E-score) |
1 |
+ |
1 |
Luciferase Reporter Assay; Western Blot |
[13] |
Representative Target(s) Regulated by This miRNA |
Apoptosis inhibitor survivin (BIRC5)
|
Target Info
|
|
Apoptosis regulator Bcl-2 (BCL-2)
|
Target Info
|
|
miRNA Mature ID |
hsa-miR-663a |
miRNA Info
|
miRNA Mature AC |
|
Sequence |
aggcggggcgccgcgggaccgc
|
miRNA Species |
Homo sapiens |
Evidence Score (E-score) |
1 |
+ |
1 |
Western Blot |
[14] |
Representative Target(s) Regulated by This miRNA |
C-X-C chemokine receptor type 4 (CXCR4)
|
Target Info
|
|
CCAAT/enhancer binding protein beta (CEBPB)
|
Target Info
|
|
miRNA Mature ID |
hsa-miR-494-5p |
miRNA Info
|
miRNA Mature AC |
|
Sequence |
agguuguccguguugucuucucu
|
miRNA Species |
Homo sapiens |
Regulation Mechanism |
miR-494 mimics significantly inhibited luciferase activity in the wild-type 3'UTR of the CXCR4 co-transfected cells as compared with the control group. |
[15] |
Evidence Score (E-score) |
1 |
+ |
1 |
Luciferase Reporter Assay; Western Blot |
[15] |
Representative Target(s) Regulated by This miRNA |
C-X-C chemokine receptor type 4 (CXCR4)
|
Target Info
|
|
Dihydrothymine dehydrogenase (DPYD)
|
Target Info
|
|
miRNA Mature ID |
hsa-miR-146a-3p |
miRNA Info
|
miRNA Mature AC |
|
Sequence |
ccucugaaauucaguucuucag
|
miRNA Species |
Homo sapiens |
Evidence Score (E-score) |
1 |
+ |
1 |
Luciferase Reporter Assay; Western Blot |
[16] |
Representative Target(s) Regulated by This miRNA |
C-X-C chemokine receptor type 4 (CXCR4)
|
Target Info
|
|