Target Regulator(s) Information (MicroRNA)

Content Navigation (  All   None )                                      
Target General Information
The microRNAs (miRNAs) Regulating This Target
References
Target General Information  Top
Target ID T25265 Target Info
Target Name Enhancer of zeste homolog 2 (EZH2)
Synonyms Lysine Nmethyltransferase 6; Lysine N-methyltransferase 6; KMT6; Histonelysine Nmethyltransferase EZH2; Histone-lysine N-methyltransferase EZH2; EZH2; ENX1; ENX-1
Target Type Successful Target
Gene Name EZH2
Biochemical Class Methyltransferase
UniProt ID
Q15910
The microRNAs (miRNAs) Regulating This Target  Top
miRNA Mature ID hsa-miR-214-3p miRNA Info
miRNA Mature AC
MIMAT0000271
Sequence acagcaggcacagacaggcagu
miRNA Species Homo sapiens
Regulation Mechanism miR-214 regulates EZH2 protein accumulation in breast cancer cells by directly targeting Ezh2 3'UTR. And miR-214 expression was inversely correlated with Ezh2 mRNA. [1]
Evidence Score (E-score) 5 +
1 Luciferase Reporter Assay; Northern Blot [1]
2 Luciferase Reporter Assay; qRT-PCR; Western Blot [2]
3 Luciferase Reporter Assay; qRT-PCR; Western Blot [3]
4 Luciferase Reporter Assay; qRT-PCR; Western Blot [4]
5 Luciferase Reporter Assay; Western Blot; qRT-PCR [5]
Representative Target(s) Regulated by This miRNA Activating transcription factor 4 (ATF-4) Target Info
ATF4_HUMAN
ADP-ribosylation factor-like protein 2 (ARL2) Target Info
ARL2_HUMAN
miRNA Mature ID hsa-miR-98-5p miRNA Info
miRNA Mature AC
MIMAT0000096
Sequence ugagguaguaaguuguauuguu
miRNA Species Homo sapiens
Evidence Score (E-score) 3 +
1 Immunoblot; Immunohistochemistry; Luciferase Reporter Assay; Microarray; qRT-PCR [6]
2 Luciferase Reporter Assay; qRT-PCR; Western Blot [7]
3 Northern Blot [1]
Representative Target(s) Regulated by This miRNA Apoptosis regulator Bcl-2 (BCL-2) Target Info
BCL2_HUMAN
Aromatase (CYP19A1) Target Info
CP19A_HUMAN
miRNA Mature ID hsa-let-7b-5p miRNA Info
miRNA Mature AC
MIMAT0000063
Sequence ugagguaguagguugugugguu
miRNA Species Homo sapiens
Regulation Mechanism Overexpression of hsa-let-7b-5p led to significant reduction in EZH2 protein level. [8]
Evidence Score (E-score) 2 +
1 qRT-PCR; Western Blot [8]
2 Western Blot [9]
Representative Target(s) Regulated by This miRNA Activin receptor-like kinase 2 (ALK-2) Target Info
ACVR1_HUMAN
CDK inhibitor 1B p27Kip1 (CDKN1B) Target Info
CDN1B_HUMAN
miRNA Mature ID hsa-let-7e-5p miRNA Info
miRNA Mature AC
MIMAT0000066
Sequence ugagguaggagguuguauaguu
miRNA Species Homo sapiens
Regulation Mechanism EZH2 expression was decreased with treatment of let-7e agomiRs. [11]
Evidence Score (E-score) 2 +
1 Luciferase Reporter Assay; Western Blot; RT-PCR [10]
2 qRT-PCR; Western Blot [11]
Representative Target(s) Regulated by This miRNA Apoptosis antigen ligand (CD178) Target Info
TNFL6_HUMAN
Aurora kinase B (AURKB) Target Info
AURKB_HUMAN
miRNA Mature ID hsa-miR-101-3p miRNA Info
miRNA Mature AC
MIMAT0000099
Sequence uacaguacugugauaacugaa
miRNA Species Homo sapiens
Regulation Mechanism The overexpression of miR-101-3p by mature miRNA precursor transfection resulted in the decreased protein level of target EZH2. [12]
Evidence Score (E-score) 2 +
1 Immunoblot; qRT-PCR; Luciferase Reporter Assay [12]
2 Luciferase Reporter Assay; Western Blot [13]
Representative Target(s) Regulated by This miRNA ATM serine/threonine kinase (ATM) Target Info
ATM_HUMAN
Enhancer of zeste homolog 2 (EZH2) Target Info
EZH2_HUMAN
miRNA Mature ID hsa-miR-124-3p miRNA Info
miRNA Mature AC
MIMAT0000422
Sequence uaaggcacgcggugaaugcc
miRNA Species Homo sapiens
Regulation Mechanism The overexpression of miR-124-3p by mature miRNA precursor transfection resulted in the decreased protein level of target EZH2. [12]
Evidence Score (E-score) 2 +
1 Western Blot; qRT-PCR; Luciferase Reporter Assay [12]
2 Western Blot; RT-PCR [14]
Representative Target(s) Regulated by This miRNA Beta-secretase 1 (BACE1) Target Info
BACE1_HUMAN
Brain-derived neurotrophic factor (BDNF) Target Info
BDNF_HUMAN
miRNA Mature ID hsa-miR-26b-5p miRNA Info
miRNA Mature AC
MIMAT0000083
Sequence uucaaguaauucaggauaggu
miRNA Species Homo sapiens
Regulation Mechanism Luciferase activity of the reporter containing the wild-type EZH2-3'UTR, but not the seed-region deletion mutant, was decreased after transfection with the miR- 26b-5p mimic supporting that the EZH2 was a direct target of miR-26b-5p. [16]
Evidence Score (E-score) 2 +
1 Luciferase Reporter Assay [15]
2 Luciferase Reporter Assay; Western Blot [16]
Representative Target(s) Regulated by This miRNA ATP-binding cassette transporter A1 (ABCA1) Target Info
ABCA1_HUMAN
Collagen I (COL1A2) Target Info
CO1A2_HUMAN
miRNA Mature ID hsa-miR-708-5p miRNA Info
miRNA Mature AC
MIMAT0004926
Sequence aaggagcuuacaaucuagcuggg
miRNA Species Homo sapiens
Regulation Mechanism Overexpression of miR-708 reduced the expression of EZH2. [18]
Evidence Score (E-score) 2 +
1 Luciferase Reporter Assay [17]
2 Western Blot [18]
Representative Target(s) Regulated by This miRNA Apoptosis inhibitor survivin (BIRC5) Target Info
BIRC5_HUMAN
Apoptosis regulator Bcl-2 (BCL-2) Target Info
BCL2_HUMAN
miRNA Mature ID hsa-miR-26a-5p miRNA Info
miRNA Mature AC
MIMAT0000082
Sequence uucaaguaauccaggauaggcu
miRNA Species Homo sapiens
Evidence Score (E-score) 2 +
1 Luciferase Reporter Assay [12]
2 Luciferase Reporter Assay [15]
Representative Target(s) Regulated by This miRNA Enhancer of zeste homolog 2 (EZH2) Target Info
EZH2_HUMAN
TGF-beta receptor type II (TGFBR2) Target Info
TGFR2_HUMAN
miRNA Mature ID hsa-miR-340-3p miRNA Info
miRNA Mature AC
MIMAT0000750
Sequence uccgucucaguuacuuuauagc
miRNA Species Homo sapiens
Regulation Mechanism miR-340 directly targets EZH2 expression in Hep-2 cells. [20]
Evidence Score (E-score) 2 +
1 Luciferase Reporter Assay [19]
2 Luciferase Reporter Assay; Western Blot [20]
Representative Target(s) Regulated by This miRNA Enhancer of zeste homolog 2 (EZH2) Target Info
EZH2_HUMAN
miRNA Mature ID hsa-miR-125a-3p miRNA Info
miRNA Mature AC
MIMAT0004602
Sequence acaggugagguucuugggagcc
miRNA Species Homo sapiens
Regulation Mechanism miR-125a-3p is a regulator of EZH2 transcript. [21]
Evidence Score (E-score) 1 +
1 Chromatin Immunoprecipitation; Western Blot [21]
Representative Target(s) Regulated by This miRNA Enhancer of zeste homolog 2 (EZH2) Target Info
EZH2_HUMAN
Fyn tyrosine protein kinase (FYN) Target Info
FYN_HUMAN
miRNA Mature ID hsa-miR-126-3p miRNA Info
miRNA Mature AC
MIMAT0000445
Sequence ucguaccgugaguaauaaugcg
miRNA Species Homo sapiens
Evidence Score (E-score) 1 +
1 Luciferase Reporter Assay; Western Blot [22]
Representative Target(s) Regulated by This miRNA Adrenomedullin (ADM) Target Info
ADML_HUMAN
Angiopoietin 1 receptor (TEK) Target Info
TIE2_HUMAN
miRNA Mature ID hsa-miR-144-3p miRNA Info
miRNA Mature AC
MIMAT0000436
Sequence uacaguauagaugauguacu
miRNA Species Homo sapiens
Regulation Mechanism miR-144 downregulation relieves miR-144-mediated repression of EZH2. [23]
Evidence Score (E-score) 1 +
1 Luciferase Reporter Assay; Western Blot [23]
Representative Target(s) Regulated by This miRNA ADAM metallopeptidase with thrombospondin 1 (ADAMTS1) Target Info
ATS1_HUMAN
Amyloid beta A4 protein (APP) Target Info
A4_HUMAN
miRNA Mature ID hsa-miR-185-5p miRNA Info
miRNA Mature AC
MIMAT0000455
Sequence uggagagaaaggcaguuccuga
miRNA Species Homo sapiens
Evidence Score (E-score) 1 +
1 Western Blot [24]
Representative Target(s) Regulated by This miRNA Androgen receptor (AR) Target Info
ANDR_HUMAN
Arachidonate 12-lipoxygenase (12-LOX) Target Info
LOX12_HUMAN
miRNA Mature ID hsa-miR-200a-3p miRNA Info
miRNA Mature AC
MIMAT0000682
Sequence uaacacugucugguaacgaugu
miRNA Species Homo sapiens
Regulation Mechanism Silencing EZH2 using drugs or RNA interference dramatically reduced the levels of miR-200a expression. [25]
Evidence Score (E-score) 1 +
1 Western Blot [25]
Representative Target(s) Regulated by This miRNA Amphiregulin (AREG) Target Info
AREG_HUMAN
Beta-catenin (CTNNB1) Target Info
CTNB1_HUMAN
miRNA Mature ID hsa-miR-200b-3p miRNA Info
miRNA Mature AC
MIMAT0000318
Sequence uaauacugccugguaaugauga
miRNA Species Homo sapiens
Regulation Mechanism Silencing EZH2 using drugs or RNA interference dramatically reduced the levels of miR-200b expression. [25]
Evidence Score (E-score) 1 +
1 Western Blot [25]
Representative Target(s) Regulated by This miRNA Apoptosis regulator Bcl-2 (BCL-2) Target Info
BCL2_HUMAN
CDK inhibitor 1B p27Kip1 (CDKN1B) Target Info
CDN1B_HUMAN
miRNA Mature ID hsa-miR-25-3p miRNA Info
miRNA Mature AC
MIMAT0000081
Sequence cauugcacuugucucggucuga
miRNA Species Homo sapiens
Regulation Mechanism EZH2 is a target of miR-25. [26]
Evidence Score (E-score) 1 +
1 Luciferase Reporter Assay; Western Blot [26]
Representative Target(s) Regulated by This miRNA CDK inhibitor 1C p57Kip2 (CDKN1C) Target Info
CDN1C_HUMAN
Cellular tumor antigen p53 (TP53) Target Info
P53_HUMAN
miRNA Mature ID hsa-miR-27a-3p miRNA Info
miRNA Mature AC
MIMAT0000084
Sequence uucacaguggcuaaguuccgc
miRNA Species Homo sapiens
Regulation Mechanism miR-27a-3p regulated EZH2 level. [27]
Evidence Score (E-score) 1 +
1 Chromatin Immunoprecipitation [27]
Representative Target(s) Regulated by This miRNA ATP-binding cassette transporter A1 (ABCA1) Target Info
ABCA1_HUMAN
Cellular tumor antigen p53 (TP53) Target Info
P53_HUMAN
miRNA Mature ID hsa-miR-30d-5p miRNA Info
miRNA Mature AC
MIMAT0000245
Sequence uguaaacauccccgacuggaag
miRNA Species Homo sapiens
Regulation Mechanism EZH2 is a target of miR-30d. [26]
Evidence Score (E-score) 1 +
1 Luciferase Reporter Assay; Western Blot [26]
Representative Target(s) Regulated by This miRNA Autophagy-related 2B (ATG2B) Target Info
ATG2B_HUMAN
Beclin-1 (BECN1) Target Info
BECN1_HUMAN
miRNA Mature ID hsa-miR-429 miRNA Info
miRNA Mature AC
MIMAT0001536
Sequence uaauacugucugguaaaaccgu
miRNA Species Homo sapiens
Regulation Mechanism Silencing EZH2 using drugs or RNA interference dramatically reduced the levels of miR-429 expression. [25]
Evidence Score (E-score) 1 +
1 Western Blot [25]
Representative Target(s) Regulated by This miRNA Apoptosis regulator Bcl-2 (BCL-2) Target Info
BCL2_HUMAN
DNA [cytosine-5]-methyltransferase 1 (DNMT1) Target Info
DNMT1_HUMAN
References  Top
REF 1 Mir-214-dependent regulation of the polycomb protein Ezh2 in skeletal muscle and embryonic stem cells. Mol Cell. 2009 Oct 9;36(1):61-74.
REF 2 MicroRNA-214 provokes cardiac hypertrophy via repression of EZH2. Biochem Biophys Res Commun. 2013 Jul 12;436(4):578-84.
REF 3 MiR-214 targets -catenin pathway to suppress invasion, stem-like traits and recurrence of human hepatocellular carcinoma. PLoS One. 2012;7(9):e44206.
REF 4 Decreased microRNA-214 levels in breast cancer cells coincides with increased cell proliferation, invasion and accumulation of the Polycomb Ezh2 methyltransferase. Carcinogenesis. 2011 Nov;32(11):1607-14.
REF 5 Cardiac hypertrophy and dysfunction induced by overexpression of miR-214 inivo. J Surg Res. 2014 Dec;192(2):317-25.
REF 6 Enhancer of Zeste homolog 2 (EZH2) is overexpressed in recurrent nasopharyngeal carcinoma and is regulated by miR-26a, miR-101, and miR-98. Cell Death Dis. 2010 Oct 21;1:e85.
REF 7 miR-98 inhibits hepatocellular carcinoma cell proliferation via targeting EZH2 and suppressing Wnt/-catenin signaling pathway. Biomed Pharmacother. 2017 Jan;85:472-478.
REF 8 Genome-wide mRNA and miRNA expression profiling reveal multiple regulatory networks in colorectal cancer. Cell Death Dis. 2015 Jan 22;6:e1614.
REF 9 Lysine-specific demethylase 2B (KDM2B)-let-7-enhancer of zester homolog 2 (EZH2) pathway regulates cell cycle progression and senescence in primary... J Biol Chem. 2011 Sep 23;286(38):33061-9.
REF 10 Let-7e inhibits TNF-alpha expression by targeting the methyl transferase EZH2 in DENV2-infected THP-1 cells. J Cell Physiol. 2018 Nov;233(11):8605-8616.
REF 11 Deregulation of let-7e in epithelial ovarian cancer promotes the development of resistance to cisplatin. Oncogenesis. 2013 Oct 7;2:e75.
REF 12 MYC stimulates EZH2 expression by repression of its negative regulator miR-26a. Blood. 2008 Nov 15;112(10):4202-12.
REF 13 Developmental epigenetic programming of adult germ cell death disease: Polycomb protein EZH2-miR-101 pathway. Epigenomics. 2016 Nov;8(11):1459-1479.
REF 14 HOXA11-AS promotes the migration and invasion of hepatocellular carcinoma cells by inhibiting miR-124 expression by binding to EZH2. Hum Cell. 2019 Oct;32(4):504-514.
REF 15 lncRNA SNHG6 regulates EZH2 expression by sponging miR-26a/b and miR-214 in colorectal cancer. J Hematol Oncol. 2019 Jan 9;12(1):3.
REF 16 Huaier suppresses proliferation and induces apoptosis in human pulmonary cancer cells via upregulation of miR-26b-5p. FEBS Lett. 2014 Jun 5;588(12):2107-14.
REF 17 Targeting Wnt/EZH2/microRNA-708 signaling pathway inhibits neuroendocrine differentiation in prostate cancer. Cell Death Discov. 2019 Sep 30;5:139.
REF 18 miR-708 acts as a tumor suppressor in human glioblastoma cells. Oncol Rep. 2013 Aug;30(2):870-6.
REF 19 MiR-340 Inhibits Triple-Negative Breast Cancer Progression by Reversing EZH2 Mediated miRNAs Dysregulated Expressions. J Cancer. 2017 Sep 2;8(15):3037-3048.
REF 20 MiR-340 impedes the progression of laryngeal squamous cell carcinoma by targeting EZH2. Gene. 2016 Feb 15;577(2):193-201.
REF 21 EZH2 inhibition in multiple myeloma downregulates myeloma associated oncogenes and upregulates microRNAs with potential tumor suppressor functions. Oncotarget. 2017 Feb 7;8(6):10213-10224.
REF 22 MicroRNA-126 increases chemosensitivity in drug-resistant gastric cancer cells by targeting EZH2. Biochem Biophys Res Commun. 2016 Oct 7;479(1):91-6.
REF 23 miR-144 downregulation increases bladder cancer cell proliferation by targeting EZH2 and regulating Wnt signaling. FEBS J. 2013 Sep;280(18):4531-8.
REF 24 GKN1-miR-185-DNMT1 axis suppresses gastric carcinogenesis through regulation of epigenetic alteration and cell cycle. Clin Cancer Res. 2013 Sep 1;19(17):4599-610.
REF 25 DNMT1 and EZH2 mediated methylation silences the microRNA-200b/a/429 gene and promotes tumor progression. Cancer Lett. 2015 Apr 10;359(2):198-205.
REF 26 Down-regulation of the miR-25 and miR-30d contributes to the development of anaplastic thyroid carcinoma targeting the polycomb protein EZH2. J Clin Endocrinol Metab. 2012 May;97(5):E710-8.
REF 27 Analysis of EZH2: micro-RNA network in low and high grade astrocytic tumors. Brain Tumor Pathol. 2016 Apr;33(2):117-28.

If You Find Any Error in Data or Bug in Web Service, Please Kindly Report It to Dr. Zhou and Dr. Zhang.