Target Regulator(s) Information (MicroRNA)

Content Navigation (  All   None )                                      
Target General Information
The microRNAs (miRNAs) Regulating This Target
References
Target General Information  Top
Target ID T88304 Target Info
Target Name DNA [cytosine-5]-methyltransferase 1 (DNMT1)
Synonyms MCMT; M.HsaI; Dnmt1; DNMT; DNA methyltransferase HsaI; DNA MTase HsaI; DNA (cytosine5)methyltransferase 1; DNA (cytosine-5)-methyltransferase 1; CXXCtype zinc finger protein 9; CXXC9; CXXC-type zinc finger protein 9; AIM
Target Type Clinical trial Target
Gene Name DNMT1
Biochemical Class Methyltransferase
UniProt ID
P26358
The microRNAs (miRNAs) Regulating This Target  Top
miRNA Mature ID hsa-miR-148a-3p miRNA Info
miRNA Mature AC
MIMAT0000243
Sequence ucagugcacuacagaacuuugu
miRNA Species Homo sapiens
Regulation Mechanism The overexpression of miR-148a-3p by mature miRNA precursor transfection resulted in the decreased protein level of target DNMT1. [4]
Evidence Score (E-score) 7 +
1 Luciferase Reporter Assay [1]
2 Luciferase Reporter Assay [2]
3 Luciferase Reporter Assay; qRT-PCR; Western Blot [3]
4 Luciferase Reporter Assay; Western Blot [4]
5 qRT-PCR; Luciferase Reporter Assay; Western Blot [5]
6 qRT-PCR; Western Blot [6]
7 qRT-PCR; Western Blot [7]
Representative Target(s) Regulated by This miRNA Activated leukocyte cell adhesionmolecule (ALCAM) Target Info
CD166_HUMAN
Activin receptor-like kinase 2 (ALK-2) Target Info
ACVR1_HUMAN
miRNA Mature ID hsa-miR-152-3p miRNA Info
miRNA Mature AC
MIMAT0000438
Sequence ucagugcaugacagaacuugg
miRNA Species Homo sapiens
Regulation Mechanism The overexpression of miR-152-3p by mature miRNA precursor transfection resulted in the decreased protein level of target DNMT1. [4]
Evidence Score (E-score) 5 +
1 Immunoblot; Immunoprecipitation; Luciferase Reporter Assay; qRT-PCR; Western Blot [8]
2 Immunoblot; Immunoprecipitation; Luciferase Reporter Assay; qRT-PCR; Western Blot [4]
3 Luciferase Reporter Assay; Microarray; qRT-PCR; Western Blot [9]
4 Luciferase Reporter Assay; qRT-PCR; Western Blot [10]
5 qRT-PCR; Luciferase Reporter Assay; Western Blot [11]
Representative Target(s) Regulated by This miRNA Activated leukocyte cell adhesionmolecule (ALCAM) Target Info
CD166_HUMAN
Dickkopf-related protein 1 (DKK1) Target Info
DKK1_HUMAN
miRNA Mature ID hsa-miR-185-5p miRNA Info
miRNA Mature AC
MIMAT0000455
Sequence uggagagaaaggcaguuccuga
miRNA Species Homo sapiens
Evidence Score (E-score) 3 +
1 Immunoprecipitation; Luciferase Reporter Assay; Western Blot [12]
2 Immunoprecipitation; qRT-PCR; Western Blot [13]
3 qRT-PCR; Luciferase Reporter Assay; Western Blot [11]
Representative Target(s) Regulated by This miRNA Androgen receptor (AR) Target Info
ANDR_HUMAN
Arachidonate 12-lipoxygenase (12-LOX) Target Info
LOX12_HUMAN
miRNA Mature ID hsa-miR-140-5p miRNA Info
miRNA Mature AC
MIMAT0000431
Sequence cagugguuuuacccuaugguag
miRNA Species Homo sapiens
Regulation Mechanism Dnmt1 was identified as a direct target of miRNA-140. [14]
Evidence Score (E-score) 2 +
1 Immunohistochemistry; Luciferase Reporter Assay; Western Blot [14]
2 Luciferase Reporter Assay [15]
Representative Target(s) Regulated by This miRNA Adenosine deaminase (ADA) Target Info
ADA_HUMAN
Aspartyl aminopeptidase (DNPEP) Target Info
DNPEP_HUMAN
miRNA Mature ID hsa-miR-29a-3p miRNA Info
miRNA Mature AC
MIMAT0000086
Sequence uagcaccaucugaaaucgguua
miRNA Species Homo sapiens
Regulation Mechanism miR-29a regulates TGF-B-induced EMT by affecting DNA methylation via the suppression of DNMT. [17]
Evidence Score (E-score) 2 +
1 Microarray; qRT-PCR [16]
2 Western Blot [17]
Representative Target(s) Regulated by This miRNA Apoptosis regulator Bcl-2 (BCL-2) Target Info
BCL2_HUMAN
Aryl hydrocarbon receptor (AHR) Target Info
AHR_HUMAN
miRNA Mature ID hsa-miR-342-3p miRNA Info
miRNA Mature AC
MIMAT0000753
Sequence ucucacacagaaaucgcacccgu
miRNA Species Homo sapiens
Regulation Mechanism DNMT1 is a candidate target gene of miR-342 and that the 3'UTR of DNMT1 is a functional target site for miR-342 in CRC cells. [19]
Evidence Score (E-score) 2 +
1 Luciferase Reporter Assay; Microarray; qRT-PCR; Western Blot [18]
2 Luciferase Reporter Assay; Western Blot [19]
Representative Target(s) Regulated by This miRNA DNA [cytosine-5]-methyltransferase 1 (DNMT1) Target Info
DNMT1_HUMAN
E2F transcription factor 1 (E2F1) Target Info
E2F1_HUMAN
miRNA Mature ID hsa-miR-126-3p miRNA Info
miRNA Mature AC
MIMAT0000445
Sequence ucguaccgugaguaauaaugcg
miRNA Species Homo sapiens
Regulation Mechanism miR-126 directly inhibits DNMT1 translation via interaction with its 3'UTR, and that overexpression of miR-126 in CD4 + T cells can significantly reduce DNMT1 protein levels. [20]
Evidence Score (E-score) 1 +
1 Luciferase Reporter Assay; Western Blot [20]
Representative Target(s) Regulated by This miRNA Adrenomedullin (ADM) Target Info
ADML_HUMAN
Angiopoietin 1 receptor (TEK) Target Info
TIE2_HUMAN
miRNA Mature ID hsa-miR-148b-3p miRNA Info
miRNA Mature AC
MIMAT0000759
Sequence ucagugcaucacagaacuuugu
miRNA Species Homo sapiens
Evidence Score (E-score) 1 +
1 Luciferase Reporter Assay [4]
Representative Target(s) Regulated by This miRNA Activated leukocyte cell adhesionmolecule (ALCAM) Target Info
CD166_HUMAN
Activin receptor-like kinase 2 (ALK-2) Target Info
ACVR1_HUMAN
miRNA Mature ID hsa-miR-17-5p miRNA Info
miRNA Mature AC
MIMAT0000070
Sequence caaagugcuuacagugcagguag
miRNA Species Homo sapiens
Regulation Mechanism Diminished miR- 17 expression inversely correlated to DNMT-1 expression. Introduction of the miR-17 reduced firbrotic gene and DNMT-1 expression, normalized cellular phenotype, and reduced DNA methylation of the cluster. [21]
Evidence Score (E-score) 1 +
1 Luciferase Reporter Assay [21]
Representative Target(s) Regulated by This miRNA Amyloid beta A4 protein (APP) Target Info
A4_HUMAN
Apoptosis mediating surface antigen FAS (FAS) Target Info
TNR6_HUMAN
miRNA Mature ID hsa-miR-18a-5p miRNA Info
miRNA Mature AC
MIMAT0000072
Sequence uaaggugcaucuagugcagauag
miRNA Species Homo sapiens
Regulation Mechanism Diminished miR-18a expression inversely correlated to DNMT-1 expression. Introduction of the miR-17 reduced firbrotic gene and DNMT-1 expression, normalized cellular phenotype, and reduced DNA methylation of the cluster. [21]
Evidence Score (E-score) 1 +
1 Luciferase Reporter Assay [21]
Representative Target(s) Regulated by This miRNA Apoptosis mediating surface antigen FAS (FAS) Target Info
TNR6_HUMAN
Apoptosis regulator Bcl-2 (BCL-2) Target Info
BCL2_HUMAN
miRNA Mature ID hsa-miR-19a-3p miRNA Info
miRNA Mature AC
MIMAT0000073
Sequence ugugcaaaucuaugcaaaacuga
miRNA Species Homo sapiens
Regulation Mechanism Diminished miR-19a expression inversely correlated to DNMT-1 expression. Introduction of the miR-17 reduced firbrotic gene and DNMT-1 expression, normalized cellular phenotype, and reduced DNA methylation of the cluster. [21]
Evidence Score (E-score) 1 +
1 Luciferase Reporter Assay [21]
Representative Target(s) Regulated by This miRNA Adrenergic receptor beta-1 (ADRB1) Target Info
ADRB1_HUMAN
Apoptosis signal-regulating kinase 1 (MAP3K5) Target Info
M3K5_HUMAN
miRNA Mature ID hsa-miR-200a-3p miRNA Info
miRNA Mature AC
MIMAT0000682
Sequence uaacacugucugguaacgaugu
miRNA Species Homo sapiens
Regulation Mechanism Silencing DNMT1 using drugs or RNA interference dramatically reduced the levels of miR-200a expression. [22]
Evidence Score (E-score) 1 +
1 Western Blot [22]
Representative Target(s) Regulated by This miRNA Amphiregulin (AREG) Target Info
AREG_HUMAN
Beta-catenin (CTNNB1) Target Info
CTNB1_HUMAN
miRNA Mature ID hsa-miR-200b-3p miRNA Info
miRNA Mature AC
MIMAT0000318
Sequence uaauacugccugguaaugauga
miRNA Species Homo sapiens
Regulation Mechanism Silencing DNMT1 using drugs or RNA interference dramatically reduced the levels of miR-200b expression. [22]
Evidence Score (E-score) 1 +
1 Western Blot [22]
Representative Target(s) Regulated by This miRNA Apoptosis regulator Bcl-2 (BCL-2) Target Info
BCL2_HUMAN
CDK inhibitor 1B p27Kip1 (CDKN1B) Target Info
CDN1B_HUMAN
miRNA Mature ID hsa-miR-20a-5p miRNA Info
miRNA Mature AC
MIMAT0000075
Sequence uaaagugcuuauagugcagguag
miRNA Species Homo sapiens
Regulation Mechanism Diminished miR-20a expression inversely correlated to DNMT-1 expression. Introduction of the miR-17 reduced firbrotic gene and DNMT-1 expression, normalized cellular phenotype, and reduced DNA methylation of the cluster. [21]
Evidence Score (E-score) 1 +
1 Luciferase Reporter Assay [21]
Representative Target(s) Regulated by This miRNA Amyloid beta A4 protein (APP) Target Info
A4_HUMAN
Apoptosis regulator Bcl-2 (BCL-2) Target Info
BCL2_HUMAN
miRNA Mature ID hsa-miR-30a-5p miRNA Info
miRNA Mature AC
MIMAT0000087
Sequence uguaaacauccucgacuggaag
miRNA Species Homo sapiens
Regulation Mechanism DNMT1 is a direct target of miR-30a-5p. [23]
Evidence Score (E-score) 1 +
1 Luciferase Reporter Assay; Western Blot [23]
Representative Target(s) Regulated by This miRNA Beclin-1 (BECN1) Target Info
BECN1_HUMAN
Brain-derived neurotrophic factor (BDNF) Target Info
BDNF_HUMAN
miRNA Mature ID hsa-miR-30b-5p miRNA Info
miRNA Mature AC
MIMAT0000420
Sequence uguaaacauccuacacucagcu
miRNA Species Homo sapiens
Regulation Mechanism miR-30b-5p is significantly diminished in gastric cancer tissues, providing the first insight into the epigenetic mechanism of miR-30b-5p down-regulation, induced by DNMT1. [24]
Evidence Score (E-score) 1 +
1 qRT-PCR; Western Blot [24]
Representative Target(s) Regulated by This miRNA Apoptosis regulator Bcl-2 (BCL-2) Target Info
BCL2_HUMAN
Beclin-1 (BECN1) Target Info
BECN1_HUMAN
miRNA Mature ID hsa-miR-377-3p miRNA Info
miRNA Mature AC
MIMAT0000730
Sequence aucacacaaaggcaacuuuugu
miRNA Species Homo sapiens
Regulation Mechanism miR-377 directly target DNMT1. [25]
Evidence Score (E-score) 1 +
1 Luciferase Reporter Assay; Western Blot [25]
Representative Target(s) Regulated by This miRNA Cellular tumor antigen p53 (TP53) Target Info
P53_HUMAN
DNA [cytosine-5]-methyltransferase 1 (DNMT1) Target Info
DNMT1_HUMAN
miRNA Mature ID hsa-miR-429 miRNA Info
miRNA Mature AC
MIMAT0001536
Sequence uaauacugucugguaaaaccgu
miRNA Species Homo sapiens
Regulation Mechanism Silencing DNMT1 using drugs or RNA interference dramatically reduced the levels of miR-429 expression. [22]
Evidence Score (E-score) 1 +
1 Western Blot [22]
Representative Target(s) Regulated by This miRNA Apoptosis regulator Bcl-2 (BCL-2) Target Info
BCL2_HUMAN
DNA [cytosine-5]-methyltransferase 1 (DNMT1) Target Info
DNMT1_HUMAN
miRNA Mature ID hsa-miR-301b-3p miRNA Info
miRNA Mature AC
MIMAT0004958
Sequence cagugcaaugauauugucaaagc
miRNA Species Homo sapiens
Evidence Score (E-score) 1 +
1 Luciferase Reporter Assay [4]
Representative Target(s) Regulated by This miRNA DNA [cytosine-5]-methyltransferase 1 (DNMT1) Target Info
DNMT1_HUMAN
Mineralocorticoid receptor (MR) Target Info
MCR_HUMAN
miRNA Mature ID hsa-miR-342-5p miRNA Info
miRNA Mature AC
MIMAT0004694
Sequence aggggugcuaucugugauuga
miRNA Species Homo sapiens
Regulation Mechanism The overexpression of miR-342-5p resulted in the decreased protein level of target DNMT1. [4]
Evidence Score (E-score) 1 +
1 Western Blot; qRT-PCR; Luciferase Reporter Assay [4]
Representative Target(s) Regulated by This miRNA DNA [cytosine-5]-methyltransferase 1 (DNMT1) Target Info
DNMT1_HUMAN
Endoglin CD105 (ENG) Target Info
EGLN_HUMAN
miRNA Mature ID hsa-miR-1264 miRNA Info
miRNA Mature AC
MIMAT0005791
Sequence caagucuuauuugagcaccuguu
miRNA Species Homo sapiens
Regulation Mechanism hsa-miR-1264 targets DNA methyltransferase-1 (DNMT1) transcripts by binding to its 3'UTR region to affect its expression. [26]
Evidence Score (E-score) 1 +
1 Western Blot [26]
Representative Target(s) Regulated by This miRNA DNA [cytosine-5]-methyltransferase 1 (DNMT1) Target Info
DNMT1_HUMAN
References  Top
REF 1 Regulation of laryngeal squamous cell cancer progression by the lncRNA H19/miR-148a-3p/DNMT1 axis. Oncotarget. 2016 Mar 8;7(10):11553-66.
REF 2 MicroRNA-148a is silenced by hypermethylation and interacts with DNA methyltransferase 1 in hepatocellular carcinogenesis. Int J Oncol. 2014 Jun;44(6):1915-22.
REF 3 RUNX3 inhibits laryngeal squamous cell carcinoma malignancy under the regulation of miR-148a-3p/DNMT1 axis. Cell Biochem Funct. 2016 Dec;34(8):597-605.
REF 4 MicroRNA-dependent regulation of DNA methyltransferase-1 and tumor suppressor gene expression by interleukin-6 in human malignant cholangiocytes. Hepatology. 2010 Mar;51(3):881-90.
REF 5 MicroRNA-21 and microRNA-148a contribute to DNA hypomethylation in lupus CD4+ T cells by directly and indirectly targeting DNA methyltransferase 1. J Immunol. 2010 Jun 15;184(12):6773-81.
REF 6 MiR-148a regulates MEG3 in gastric cancer by targeting DNA methyltransferase 1. Med Oncol. 2014 Mar;31(3):879.
REF 7 MicroRNA-148a is silenced by hypermethylation and interacts with DNA methyltransferase 1 in gastric cancer. Med Oncol. 2012 Dec;29(4):2701-9.
REF 8 MicroRNA-152 targets DNA methyltransferase 1 in NiS-transformed cells via a feedback mechanism. Carcinogenesis. 2013 Feb;34(2):446-53.
REF 9 MicroRNA mediates DNA demethylation events triggered by retinoic acid during neuroblastoma cell differentiation. Cancer Res. 2010 Oct 15;70(20):7874-81.
REF 10 Down-regulated microRNA-152 induces aberrant DNA methylation in hepatitis B virus-related hepatocellular carcinoma by targeting DNA methyltransferase 1. Hepatology. 2010 Jul;52(1):60-70.
REF 11 MiR-152 and miR-185 co-contribute to ovarian cancer cells cisplatin sensitivity by targeting DNMT1 directly: a novel epigenetic therapy independent of decitabine. Oncogene. 2014 Jan 16;33(3):378-86.
REF 12 MiR-185 targets the DNA methyltransferases 1 and regulates global DNA methylation in human glioma. Mol Cancer. 2011 Sep 30;10:124.
REF 13 GKN1-miR-185-DNMT1 axis suppresses gastric carcinogenesis through regulation of epigenetic alteration and cell cycle. Clin Cancer Res. 2013 Sep 1;19(17):4599-610.
REF 14 MicroRNA-140 acts as a liver tumor suppressor by controlling NF-B activity by directly targeting DNA methyltransferase 1 (Dnmt1) expression. Hepatology. 2013 Jan;57(1):162-70.
REF 15 MiR-140-5p regulates hypoxia-mediated human pulmonary artery smooth muscle cell proliferation, apoptosis and differentiation by targeting Dnmt1 and promoting SOD2 expression. Biochem Biophys Res Commun. 2016 Apr 22;473(1):342-348.
REF 16 Potential roles of microRNA-29a in the molecular pathophysiology of T-cell acute lymphoblastic leukemia. Cancer Sci. 2015 Oct;106(10):1264-77.
REF 17 Involvement of miRNA-29a in epigenetic regulation of transforming growth factor--induced epithelial-mesenchymal transition in hepatocellular carcinoma. Hepatol Res. 2014 Aug;44(8):907-19.
REF 18 miRNA-342 Regulates CEACAM1-induced Lumen Formation in a Three-dimensional Model of Mammary Gland Morphogenesis. J Biol Chem. 2016 Aug 5;291(32):16777-86.
REF 19 MicroRNA-342 inhibits colorectal cancer cell proliferation and invasion by directly targeting DNA methyltransferase 1. Carcinogenesis. 2011 Jul;32(7):1033-42.
REF 20 MicroRNA-126 regulates DNA methylation in CD4+ T cells and contributes to systemic lupus erythematosus by targeting DNA methyltransferase 1. Arthritis Rheum. 2011 May;63(5):1376-86.
REF 21 Epigenetic regulation of miR-17~92 contributes to the pathogenesis of pulmonary fibrosis. Am J Respir Crit Care Med. 2013 Feb 15;187(4):397-405.
REF 22 DNMT1 and EZH2 mediated methylation silences the microRNA-200b/a/429 gene and promotes tumor progression. Cancer Lett. 2015 Apr 10;359(2):198-205.
REF 23 A Feedback Loop Between miR-30a/c-5p and DNMT1 Mediates Cisplatin Resistance in Ovarian Cancer Cells. Cell Physiol Biochem. 2017;41(3):973-986.
REF 24 Decreased miR-30b-5p expression by DNMT1 methylation regulation involved in gastric cancer metastasis. Mol Biol Rep. 2014 Sep;41(9):5693-700.
REF 25 miR-377 induces senescence in human skin fibroblasts by targeting DNA methyltransferase 1. Cell Death Dis. 2017 Mar 9;8(3):e2663.
REF 26 Down-regulation of hsa-miR-1264 contributes to DNMT1-mediated silencing of SOCS3. Mol Biol Rep. 2015 Sep;42(9):1365-76.

If You Find Any Error in Data or Bug in Web Service, Please Kindly Report It to Dr. Zhou and Dr. Zhang.