Target Regulator(s) Information (MicroRNA)

Content Navigation (  All   None )                                      
Target General Information
The microRNAs (miRNAs) Regulating This Target
References
Target General Information  Top
Target ID T00724 Target Info
Target Name Transcription factor SOX-2 (SOX2)
Synonyms SRY-box 2; MCOPS3; ANOP3
Target Type Literature-reported Target
Gene Name SOX2
UniProt ID
P48431
The microRNAs (miRNAs) Regulating This Target  Top
miRNA Mature ID hsa-miR-145-5p miRNA Info
miRNA Mature AC
MIMAT0000437
Sequence guccaguuuucccaggaaucccu
miRNA Species Homo sapiens
Regulation Mechanism miR-145 overexpression inhibited cell proliferation and induced down-regulation of SOX2. [4]
Evidence Score (E-score) 5 +
1 GFP Reporter Assay; Luciferase Reporter Assay; qRT-PCR [1]
2 Luciferase Reporter Assay [2]
3 Luciferase Reporter Assay; qRT-PCR; Western Blot [3]
4 qRT-PCR [4]
5 qRT-PCR; Western Blot [5]
Representative Target(s) Regulated by This miRNA A proliferation-inducing ligand (APRIL) Target Info
TNF13_HUMAN
Alkaline phosphatase (ALPPL2) Target Info
PPBN_HUMAN
miRNA Mature ID hsa-miR-21-5p miRNA Info
miRNA Mature AC
MIMAT0000076
Sequence uagcuuaucagacugauguuga
miRNA Species Homo sapiens
Regulation Mechanism miR-21, directly or through an intermediate target, participates in the up-regulation of SOX2 in these cells. [8]
Evidence Score (E-score) 3 +
1 Immunoblot; Immunohistochemistry; In Situ Hybridization; Northern Blot; qRT-PCR [6]
2 Immunofluorescence; Luciferase Reporter Assay; qRT-PCR; Western Blot [7]
3 Microarray [8]
Representative Target(s) Regulated by This miRNA Apoptosis antigen ligand (CD178) Target Info
TNFL6_HUMAN
Apoptosis regulator Bcl-2 (BCL-2) Target Info
BCL2_HUMAN
miRNA Mature ID hsa-miR-126-3p miRNA Info
miRNA Mature AC
MIMAT0000445
Sequence ucguaccgugaguaauaaugcg
miRNA Species Homo sapiens
Regulation Mechanism miR-126 inhibited SOX2 expression by targeting two binding sites in the 3'-untranslated region (3'UTR) of SOX2 mRNA. [9]
Evidence Score (E-score) 2 +
1 Immunohistochemistry; Luciferase Reporter Assay; Western Blot [9]
2 Luciferase Reporter Assay [10]
Representative Target(s) Regulated by This miRNA Adrenomedullin (ADM) Target Info
ADML_HUMAN
Angiopoietin 1 receptor (TEK) Target Info
TIE2_HUMAN
miRNA Mature ID hsa-miR-140-5p miRNA Info
miRNA Mature AC
MIMAT0000431
Sequence cagugguuuuacccuaugguag
miRNA Species Homo sapiens
Regulation Mechanism miR-140 negatively regulates SOX2 expression in normal mammary epithelium. [11]
Evidence Score (E-score) 2 +
1 Luciferase Reporter Assay [11]
2 qRT-PCR [12]
Representative Target(s) Regulated by This miRNA Adenosine deaminase (ADA) Target Info
ADA_HUMAN
Aspartyl aminopeptidase (DNPEP) Target Info
DNPEP_HUMAN
miRNA Mature ID hsa-miR-638 miRNA Info
miRNA Mature AC
MIMAT0003308
Sequence agggaucgcgggcggguggcggccu
miRNA Species Homo sapiens
Regulation Mechanism SOX2 was a bona fide target of miR-638. [14]
Evidence Score (E-score) 2 +
1 Immunohistochemistry; Luciferase Reporter Assay; qRT-PCR; Western Blot [13]
2 Luciferase Reporter Assay; Immunofluorescence; Western Blot [14]
Representative Target(s) Regulated by This miRNA Cellular tumor antigen p53 (TP53) Target Info
P53_HUMAN
Cyclin-dependent kinase 2 (CDK2) Target Info
CDK2_HUMAN
miRNA Mature ID hsa-miR-146a-5p miRNA Info
miRNA Mature AC
MIMAT0000449
Sequence ugagaacugaauuccauggguu
miRNA Species Homo sapiens
Regulation Mechanism Overexpression of miR-146a resulted in the decreased protein level of SOX2. [15]
Evidence Score (E-score) 1 +
1 Luciferase Reporter Assay; Western Blot [15]
Representative Target(s) Regulated by This miRNA Activation B7-1 antigen (CD80) Target Info
CD80_HUMAN
Apoptosis mediating surface antigen FAS (FAS) Target Info
TNR6_HUMAN
miRNA Mature ID hsa-miR-340-5p miRNA Info
miRNA Mature AC
MIMAT0004692
Sequence uuauaaagcaaugagacugauu
miRNA Species Homo sapiens
Regulation Mechanism SOX2 was also determined to be significantly downregulated post miR-340 transfection at mRNA and protein level. [16]
Evidence Score (E-score) 1 +
1 qRT-PCR; Western Blot [16]
Representative Target(s) Regulated by This miRNA Cyclin-dependent kinase 6 (CDK6) Target Info
CDK6_HUMAN
G1/S-specific cyclin-D1 (CCND1) Target Info
CCND1_HUMAN
miRNA Mature ID hsa-miR-34a-5p miRNA Info
miRNA Mature AC
MIMAT0000255
Sequence uggcagugucuuagcugguugu
miRNA Species Homo sapiens
Regulation Mechanism Suppression of reprogramming by miR-34a was due, at least in part, to repression of pluripotency genes, including Sox2. [17]
Evidence Score (E-score) 1 +
1 Luciferase Reporter Assay; Western Blot [17]
Representative Target(s) Regulated by This miRNA Amphiregulin (AREG) Target Info
AREG_HUMAN
Androgen receptor (AR) Target Info
ANDR_HUMAN
miRNA Mature ID hsa-miR-34b-3p miRNA Info
miRNA Mature AC
MIMAT0004676
Sequence caaucacuaacuccacugccau
miRNA Species Homo sapiens
Evidence Score (E-score) 1 +
1 Luciferase Reporter Assay; Western Blot [17]
Representative Target(s) Regulated by This miRNA Apoptosis regulator Bcl-2 (BCL-2) Target Info
BCL2_HUMAN
Cyclic AMP-responsive element-binding protein (CREB1) Target Info
CREB1_HUMAN
miRNA Mature ID hsa-miR-34c-5p miRNA Info
miRNA Mature AC
MIMAT0000686
Sequence aggcaguguaguuagcugauugc
miRNA Species Homo sapiens
Evidence Score (E-score) 1 +
1 Luciferase Reporter Assay; Western Blot [17]
Representative Target(s) Regulated by This miRNA Apoptosis regulator Bcl-2 (BCL-2) Target Info
BCL2_HUMAN
Cyclin-dependent kinase 4 (CDK4) Target Info
CDK4_HUMAN
miRNA Mature ID hsa-miR-429 miRNA Info
miRNA Mature AC
MIMAT0001536
Sequence uaauacugucugguaaaaccgu
miRNA Species Homo sapiens
Regulation Mechanism SOX2 is a direct target of miR-429. [18]
Evidence Score (E-score) 1 +
1 Luciferase Reporter Assay; Western Blot [18]
Representative Target(s) Regulated by This miRNA Apoptosis regulator Bcl-2 (BCL-2) Target Info
BCL2_HUMAN
DNA [cytosine-5]-methyltransferase 1 (DNMT1) Target Info
DNMT1_HUMAN
miRNA Mature ID hsa-miR-625-5p miRNA Info
miRNA Mature AC
MIMAT0003294
Sequence agggggaaaguucuauagucc
miRNA Species Homo sapiens
Regulation Mechanism Sox2, a target gene of miR-625, was examined by luciferase assay and western blot. And miR-625 may regulate the biological processes of EC via controlling Sox2 expression. [19]
Evidence Score (E-score) 1 +
1 Luciferase Reporter Assay; Western Blot [19]
Representative Target(s) Regulated by This miRNA Fragile histidine triad protein (FHIT) Target Info
FHIT_HUMAN
High mobility group protein HMG-I/Y (HMGA1) Target Info
HMGA1_HUMAN
miRNA Mature ID hsa-miR-1181 miRNA Info
miRNA Mature AC
MIMAT0005826
Sequence ccgucgccgccacccgagccg
miRNA Species Homo sapiens
Evidence Score (E-score) 1 +
1 Luciferase Reporter Assay; Western Blot [20]
Representative Target(s) Regulated by This miRNA Signal transducer and activator of transcription 3 (STAT3) Target Info
STAT3_HUMAN
Transcription factor SOX-2 (SOX2) Target Info
SOX2_HUMAN
miRNA Mature ID hsa-miR-371a-5p miRNA Info
miRNA Mature AC
MIMAT0004687
Sequence acucaaacugugggggcacu
miRNA Species Homo sapiens
Regulation Mechanism miR-371-5p expression is strongly upregulated in gastric cancer tissues and negatively correlated with SOX2 expression. [21]
Evidence Score (E-score) 1 +
1 Immunohistochemistry; Luciferase Reporter Assay; Western Blot [21]
Representative Target(s) Regulated by This miRNA Epithelial cadherin (CDH1) Target Info
CADH1_HUMAN
Heat shock protein 90 alpha (HSP90A) Target Info
HS90A_HUMAN
miRNA Mature ID hsa-miR-450b-5p miRNA Info
miRNA Mature AC
MIMAT0004909
Sequence uuuugcaauauguuccugaaua
miRNA Species Homo sapiens
Regulation Mechanism miR-450b-5p directly targeted SOX2. [22]
Evidence Score (E-score) 1 +
1 Luciferase Reporter Assay; Western Blot [22]
Representative Target(s) Regulated by This miRNA Transcription factor SOX-2 (SOX2) Target Info
SOX2_HUMAN
miRNA Mature ID hsa-miR-522-3p miRNA Info
miRNA Mature AC
MIMAT0002868
Sequence aaaaugguucccuuuagagugu
miRNA Species Homo sapiens
Evidence Score (E-score) 1 +
1 Luciferase Reporter Assay; Western Blot [9]
Representative Target(s) Regulated by This miRNA Transcription factor SOX-2 (SOX2) Target Info
SOX2_HUMAN
References  Top
REF 1 MicroRNA-145 regulates OCT4, SOX2, and KLF4 and represses pluripotency in human embryonic stem cells. Cell. 2009 May 15;137(4):647-58.
REF 2 Endogenous miRNA sponge lincRNA-RoR regulates Oct4, Nanog, and Sox2 in human embryonic stem cell self-renewal. Dev Cell. 2013 Apr 15;25(1):69-80.
REF 3 Isorhapontigenin suppresses growth of patient-derived glioblastoma spheres through regulating miR-145/SOX2/cyclin D1 axis. Neuro Oncol. 2016 Jun;18(6):830-9.
REF 4 MicroRNA miR-145 inhibits proliferation, invasiveness, and stem cell phenotype of an initro endometriosis model by targeting multiple cytoskeletal elements and pluripotency factors. Fertil Steril. 2013 Apr;99(5):1346-1355.e5.
REF 5 miR-21 and miR-145 cooperation in regulation of colon cancer stem cells. Mol Cancer. 2015 May 1;14:98.
REF 6 miRNA-21 is developmentally regulated in mouse brain and is co-expressed with SOX2 in glioma. BMC Cancer. 2012 Aug 29;12:378.
REF 7 Mir-21-Sox2 Axis Delineates Glioblastoma Subtypes with Prognostic Impact. J Neurosci. 2015 Nov 11;35(45):15097-112.
REF 8 MicroRNA 21 promotes glioma invasion by targeting matrix metalloproteinase regulators. Mol Cell Biol. 2008 Sep;28(17):5369-80.
REF 9 MicroRNA-126 inhibits SOX2 expression and contributes to gastric carcinogenesis. PLoS One. 2011 Jan 27;6(1):e16617.
REF 10 miR-126 functions as a tumor suppressor in osteosarcoma by targeting Sox2. Int J Mol Sci. 2013 Dec 31;15(1):423-37.
REF 11 Estrogen receptor signaling regulates breast tumor-initiating cells by down-regulating miR-140 which targets the transcription factor SOX2. J Biol Chem. 2012 Nov 30;287(49):41514-22.
REF 12 Roles of microRNA-140 in stem cell-associated early stage breast cancer. World J Stem Cells. 2014 Nov 26;6(5):591-7.
REF 13 Loss of miR-638 promotes invasion and epithelial-mesenchymal transition by targeting SOX2 in hepatocellular carcinoma. Oncol Rep. 2017 Jan;37(1):323-332.
REF 14 Loss of miR-638 in vitro promotes cell invasion and a mesenchymal-like transition by influencing SOX2 expression in colorectal carcinoma cells. Mol Cancer. 2014 May 23;13:118.
REF 15 Decrease of miR-146a is associated with the aggressiveness of human oral squamous cell carcinoma. Arch Oral Biol. 2015 Sep;60(9):1416-27.
REF 16 Modulation of neuroblastoma disease pathogenesis by an extensive network of epigenetically regulated microRNAs. Oncogene. 2013 Jun 13;32(24):2927-36.
REF 17 miR-34 miRNAs provide a barrier for somatic cell reprogramming. Nat Cell Biol. 2011 Oct 23;13(11):1353-60.
REF 18 MiR-429 is an independent prognostic factor in colorectal cancer and exerts its anti-apoptotic function by targeting SOX2. Cancer Lett. 2013 Feb 1;329(1):84-90.
REF 19 miR-625 down-regulation promotes proliferation and invasion in esophageal cancer by targeting Sox2. FEBS Lett. 2014 Mar 18;588(6):915-21.
REF 20 MiR-1181 inhibits stem cell-like phenotypes and suppresses SOX2 and STAT3 in human pancreatic cancer. Cancer Lett. 2015 Jan 28;356(2 Pt B):962-70.
REF 21 MicroRNA-371-5p targets SOX2 in gastric cancer. Oncotarget. 2016 May 31;7(22):31993-2005.
REF 22 miR-450b-5p Suppresses Stemness and the Development of Chemoresistance by Targeting SOX2 in Colorectal Cancer. DNA Cell Biol. 2016 May;35(5):249-56.

If You Find Any Error in Data or Bug in Web Service, Please Kindly Report It to Dr. Zhou and Dr. Zhang.