Target Regulator(s) Information (MicroRNA)

Content Navigation (  All   None )                                      
Target General Information
The microRNAs (miRNAs) Regulating This Target
References
Target General Information  Top
Target ID T81916 Target Info
Target Name Kruppel like factor 4 (KLF4)
Synonyms Krueppellike factor 4; Krueppel-like factor 4; Gutenriched krueppellike factor; Gut-enriched krueppel-like factor; GKLF; Epithelial zinc finger protein EZF; EZF
Target Type Clinical trial Target
Gene Name KLF4
UniProt ID
O43474
The microRNAs (miRNAs) Regulating This Target  Top
miRNA Mature ID hsa-miR-10b-5p miRNA Info
miRNA Mature AC
MIMAT0000254
Sequence uacccuguagaaccgaauuugug
miRNA Species Homo sapiens
Regulation Mechanism The overexpression of miR-10b-5p by mature miRNA mimics tranfection resulted in the decreased protein level of target KLF4. [4]
Evidence Score (E-score) 7 +
1 Luciferase Reporter Assay [1]
2 Luciferase Reporter Assay; qRT-PCR; Western Blot [2]
3 Luciferase Reporter Assay; qRT-PCR; Western Blot [3]
4 Luciferase Reporter Assay; qRT-PCR; Western Blot [4]
5 Luciferase Reporter Assay; Western Blot [5]
6 Luciferase Reporter Assay; Western Blot [6]
7 qRT-PCR; Western Blot [7]
Representative Target(s) Regulated by This miRNA Cellular tumor antigen p53 (TP53) Target Info
P53_HUMAN
Cyclic AMP-responsive element-binding protein (CREB1) Target Info
CREB1_HUMAN
miRNA Mature ID hsa-miR-145-5p miRNA Info
miRNA Mature AC
MIMAT0000437
Sequence guccaguuuucccaggaaucccu
miRNA Species Homo sapiens
Regulation Mechanism After transfection of miR-145-5p, there was significant repression on the wild-type 30 UTR luciferase reporter activities of KLF4. The mutant reporters with a 6 bp deletion of the miR-145 target sites had significantly less repression than the wild-type reporters. [4]
Evidence Score (E-score) 5 +
1 Luciferase Reporter Assay; qRT-PCR; Western Blot [8]
2 Luciferase Reporter Assay; qRT-PCR; Western Blot [9]
3 Luciferase Reporter Assay; Western Blot [4]
4 Northern Blot; qRT-PCR; Western Blot [10]
5 qRT-PCR; Western Blot [11]
Representative Target(s) Regulated by This miRNA A proliferation-inducing ligand (APRIL) Target Info
TNF13_HUMAN
Alkaline phosphatase (ALPPL2) Target Info
PPBN_HUMAN
miRNA Mature ID hsa-miR-34a-5p miRNA Info
miRNA Mature AC
MIMAT0000255
Sequence uggcagugucuuagcugguugu
miRNA Species Homo sapiens
Regulation Mechanism miR-34a targets the 3'untranslated mRNA region of KLF4 and the effects of miR-34a on apoptosis occur due to the downregulation of KLF4. [14]
Evidence Score (E-score) 3 +
1 Immunoblot; qRT-PCR [12]
2 Luciferase Reporter Assay; qRT-PCR; Western Blot [13]
3 Luciferase Reporter Assay; Western Blot [14]
Representative Target(s) Regulated by This miRNA Amphiregulin (AREG) Target Info
AREG_HUMAN
Androgen receptor (AR) Target Info
ANDR_HUMAN
miRNA Mature ID hsa-miR-152-3p miRNA Info
miRNA Mature AC
MIMAT0000438
Sequence ucagugcaugacagaacuugg
miRNA Species Homo sapiens
Evidence Score (E-score) 2 +
1 Immunoprecipitation; qRT-PCR; Western Blot; Luciferase Reporter Assay [15]
2 PAR-CLIP [16]
Representative Target(s) Regulated by This miRNA Activated leukocyte cell adhesionmolecule (ALCAM) Target Info
CD166_HUMAN
Dickkopf-related protein 1 (DKK1) Target Info
DKK1_HUMAN
miRNA Mature ID hsa-miR-25-3p miRNA Info
miRNA Mature AC
MIMAT0000081
Sequence cauugcacuugucucggucuga
miRNA Species Homo sapiens
Regulation Mechanism miR-25 suppressed 3T3-L1 adipogenesis by targeting KLF4 and C/EBP a. [18]
Evidence Score (E-score) 2 +
1 Luciferase Reporter Assay [17]
2 Western Blot [18]
Representative Target(s) Regulated by This miRNA CDK inhibitor 1C p57Kip2 (CDKN1C) Target Info
CDN1C_HUMAN
Cellular tumor antigen p53 (TP53) Target Info
P53_HUMAN
miRNA Mature ID hsa-miR-29a-3p miRNA Info
miRNA Mature AC
MIMAT0000086
Sequence uagcaccaucugaaaucgguua
miRNA Species Homo sapiens
Regulation Mechanism miR-29 directly targets KLF4. [20]
Evidence Score (E-score) 2 +
1 Immunoprecipitation; Luciferase Reporter Assay; qRT-PCR; Western Blot [19]
2 Reporter Assay [20]
Representative Target(s) Regulated by This miRNA Apoptosis regulator Bcl-2 (BCL-2) Target Info
BCL2_HUMAN
Aryl hydrocarbon receptor (AHR) Target Info
AHR_HUMAN
miRNA Mature ID hsa-miR-32-5p miRNA Info
miRNA Mature AC
MIMAT0000090
Sequence uauugcacauuacuaaguugca
miRNA Species Homo sapiens
Regulation Mechanism miR-32 promotes gastric cancer cell proliferation, migration and invasion by targeting KLF4, suggesting that the miR-32-KLF4 pathway may be useful in clinical diagnosis and therapeutics. [22]
Evidence Score (E-score) 2 +
1 Luciferase Reporter Assay; qRT-PCR; Western Blot [21]
2 Luciferase Reporter Assay; Western Blot [22]
Representative Target(s) Regulated by This miRNA Aurora kinase A (AURKA) Target Info
AURKA_HUMAN
F-box and WD-40 domain protein 7 (Fbxw7) Target Info
FBXW7_HUMAN
miRNA Mature ID hsa-miR-367-3p miRNA Info
miRNA Mature AC
MIMAT0000719
Sequence aauugcacuuuagcaaugguga
miRNA Species Homo sapiens
Evidence Score (E-score) 2 +
1 Luciferase Reporter Assay; qRT-PCR; Western Blot [23]
2 Luciferase Reporter Assay; qRT-PCR; Western Blot [4]
Representative Target(s) Regulated by This miRNA F-box and WD-40 domain protein 7 (Fbxw7) Target Info
FBXW7_HUMAN
Kruppel like factor 4 (KLF4) Target Info
KLF4_HUMAN
miRNA Mature ID hsa-miR-107 miRNA Info
miRNA Mature AC
MIMAT0000104
Sequence agcagcauuguacagggcuauca
miRNA Species Homo sapiens
Regulation Mechanism miR-107 suppress the expression of KLF4 by targeting it 3'UTR. [24]
Evidence Score (E-score) 1 +
1 Luciferase Reporter Assay; Western Blot [24]
Representative Target(s) Regulated by This miRNA Beta-secretase 1 (BACE1) Target Info
BACE1_HUMAN
Caveolin 1 (CAV1) Target Info
CAV1_HUMAN
miRNA Mature ID hsa-miR-130a-3p miRNA Info
miRNA Mature AC
MIMAT0000425
Sequence cagugcaauguuaaaagggcau
miRNA Species Homo sapiens
Regulation Mechanism Increased level of miR-130a in M1 patient blasts would decrease the level of KLF4. [25]
Evidence Score (E-score) 1 +
1 Luciferase Reporter Assay [25]
Representative Target(s) Regulated by This miRNA Activin receptor-like kinase 2 (ALK-2) Target Info
ACVR1_HUMAN
Amyloid beta A4 protein (APP) Target Info
A4_HUMAN
miRNA Mature ID hsa-miR-135b-5p miRNA Info
miRNA Mature AC
MIMAT0000758
Sequence uauggcuuuucauuccuauguga
miRNA Species Homo sapiens
Regulation Mechanism Increased level of miR-135b in M1 patient blasts would decrease the level of KLF4. [25]
Evidence Score (E-score) 1 +
1 Luciferase Reporter Assay [25]
Representative Target(s) Regulated by This miRNA Activin receptor type IB (ACVR1B) Target Info
ACV1B_HUMAN
Bone morphogenetic protein receptor (BMPR2) Target Info
BMPR2_HUMAN
miRNA Mature ID hsa-miR-15a-5p miRNA Info
miRNA Mature AC
MIMAT0000068
Sequence uagcagcacauaaugguuugug
miRNA Species Homo sapiens
Regulation Mechanism Blockade of miR-15a attenuates the anti-angiogenic effect of KLF4. [26]
Evidence Score (E-score) 1 +
1 Western Blot [26]
Representative Target(s) Regulated by This miRNA Amyloid beta A4 protein (APP) Target Info
A4_HUMAN
Apoptosis regulator Bcl-2 (BCL-2) Target Info
BCL2_HUMAN
miRNA Mature ID hsa-miR-206 miRNA Info
miRNA Mature AC
MIMAT0000462
Sequence uggaauguaaggaagugugugg
miRNA Species Homo sapiens
Regulation Mechanism KLF4 was down-regulated by stable expression of exogenous miR-206. [27]
Evidence Score (E-score) 1 +
1 qRT-PCR [27]
Representative Target(s) Regulated by This miRNA Annexin A2 (ANXA2) Target Info
ANXA2_HUMAN
Apoptosis regulator Bcl-2 (BCL-2) Target Info
BCL2_HUMAN
miRNA Mature ID hsa-miR-29c-3p miRNA Info
miRNA Mature AC
MIMAT0000681
Sequence uagcaccauuugaaaucgguua
miRNA Species Homo sapiens
Regulation Mechanism KLF4 is a direct target of miR-29 in SMCs. [28]
Evidence Score (E-score) 1 +
1 Luciferase Reporter Assay; Western Blot [28]
Representative Target(s) Regulated by This miRNA Apoptosis regulator Bcl-2 (BCL-2) Target Info
BCL2_HUMAN
B7 homolog 3 (CD276) Target Info
CD276_HUMAN
miRNA Mature ID hsa-miR-663a miRNA Info
miRNA Mature AC
MIMAT0003326
Sequence aggcggggcgccgcgggaccgc
miRNA Species Homo sapiens
Evidence Score (E-score) 1 +
1 Microarray [29]
Representative Target(s) Regulated by This miRNA C-X-C chemokine receptor type 4 (CXCR4) Target Info
CXCR4_HUMAN
CCAAT/enhancer binding protein beta (CEBPB) Target Info
CEBPB_HUMAN
miRNA Mature ID hsa-miR-137-3p miRNA Info
miRNA Mature AC
MIMAT0000429
Sequence uuauugcuuaagaauacgcguag
miRNA Species Homo sapiens
Regulation Mechanism The overexpression of miR-137-3p by mature miRNA precursor transfection resulted in the changed mRNA level of target KLF4. [4]
Evidence Score (E-score) 1 +
1 qRT-PCR [4]
Representative Target(s) Regulated by This miRNA Cyclin-dependent kinase 6 (CDK6) Target Info
CDK6_HUMAN
Kruppel like factor 4 (KLF4) Target Info
KLF4_HUMAN
References  Top
REF 1 The human nucleophosmin 1 mutation A inhibits myeloid differentiation of leukemia cells by modulating miR-10b. Oncotarget. 2016 Nov 1;7(44):71477-71490.
REF 2 Augmented miR-10b expression associated with depressed expression of its target gene KLF4 involved in gastric carcinoma. Int J Clin Exp Pathol. 2015 May 1;8(5):5071-9.
REF 3 MicroRNA-10b promotes migration and invasion through KLF4 and HOXD10 in human bladder cancer. Oncol Rep. 2014 Apr;31(4):1832-8.
REF 4 MicroRNA-145 regulates OCT4, SOX2, and KLF4 and represses pluripotency in human embryonic stem cells. Cell. 2009 May 15;137(4):647-58.
REF 5 miR-10b promotes invasion by targeting KLF4 in osteosarcoma cells. Biomed Pharmacother. 2016 Dec;84:947-953.
REF 6 MicroRNA-10b promotes migration and invasion through KLF4 in human esophageal cancer cell lines. J Biol Chem. 2010 Mar 12;285(11):7986-94.
REF 7 MicroRNA-10b overexpression promotes non-small cell lung cancer cell proliferation and invasion. Eur J Med Res. 2013 Nov 12;18:41.
REF 8 MiR-145 negatively regulates Warburg effect by silencing KLF4 and PTBP1 in bladder cancer cells. Oncotarget. 2017 May 16;8(20):33064-33077.
REF 9 Angiotensin II Downregulates MicroRNA-145 to Regulate Kruppel-like Factor 4 and Myocardin Expression in Human Coronary Arterial Smooth Muscle Cells under High Glucose Conditions. Mol Med. 2015 Jul 14;21:616-25.
REF 10 Effects of miRNA-145 on airway smooth muscle cells function. Mol Cell Biochem. 2015 Nov;409(1-2):135-43.
REF 11 Induction of angiotensin-converting enzyme after miR-143/145 deletion is critical for impaired smooth muscle contractility. Am J Physiol Cell Physiol. 2014 Dec 15;307(12):C1093-101.
REF 12 FoxO3 increases miR-34a to cause palmitate-induced cholangiocyte lipoapoptosis. J Lipid Res. 2017 May;58(5):866-875.
REF 13 miR-34a-5p suppresses colorectal cancer metastasis and predicts recurrence in patients with stage II/III colorectal cancer. Oncogene. 2015 Jul 30;34(31):4142-52.
REF 14 MiR-34a regulates apoptosis in liver cells by targeting the KLF4 gene. Cell Mol Biol Lett. 2014 Mar;19(1):52-64.
REF 15 MiR-152 functions as a tumor suppressor in glioblastoma stem cells by targeting Krpel-like factor 4. Cancer Lett. 2014 Dec 1;355(1):85-95.
REF 16 TP53 regulates miRNA association with AGO2 to remodel the miRNA-mRNA interaction network. Genome Res. 2016 Mar;26(3):331-41.
REF 17 MiR-25 suppresses 3T3-L1 adipogenesis by directly targeting KLF4 and C/EBP. J Cell Biochem. 2015 Nov;116(11):2658-66.
REF 18 MicroRNA expression in human airway smooth muscle cells: role of miR-25 in regulation of airway smooth muscle phenotype. Am J Respir Cell Mol Biol. 2010 Apr;42(4):506-13.
REF 19 MicroRNA-29a promotes colorectal cancer metastasis by regulating matrix metalloproteinase 2 and E-cadherin via KLF4. Br J Cancer. 2014 Jan 21;110(2):450-8.
REF 20 Progestin suppression of miR-29 potentiates dedifferentiation of breast cancer cells via KLF4. Oncogene. 2013 May 16;32(20):2555-64.
REF 21 The lncRNA SNHG5/miR-32 axis regulates gastric cancer cell proliferation and migration by targeting KLF4. FASEB J. 2017 Mar;31(3):893-903.
REF 22 MiR-32 promotes gastric carcinoma tumorigenesis by targeting Kruppel-like factor 4. Biochem Biophys Res Commun. 2015 Nov 27;467(4):913-20.
REF 23 MiR-367 negatively regulates apoptosis induced by adriamycin in osteosarcoma cells by targeting KLF4. J Bone Oncol. 2016 Feb 17;5(2):51-6.
REF 24 miR-103/107 promote metastasis of colorectal cancer by targeting the metastasis suppressors DAPK and KLF4. Cancer Res. 2012 Jul 15;72(14):3631-41.
REF 25 Expression profiling of cytogenetically normal acute myeloid leukemia identifies microRNAs that target genes involved in monocytic differentiation. Am J Hematol. 2011 Jan;86(1):2-11.
REF 26 Key role of microRNA-15a in the KLF4 suppressions of proliferation and angiogenesis in endothelial and vascular smooth muscle cells. Biochem Biophys Res Commun. 2013 Aug 9;437(4):625-31.
REF 27 MicroRNA-206 suppresses gastric cancer cell growth and metastasis. Cell Biosci. 2014 May 5;4:26.
REF 28 Disruption of miR-29 Leads to Aberrant Differentiation of Smooth Muscle Cells Selectively Associated with Distal Lung Vasculature. PLoS Genet. 2015 May 28;11(5):e1005238.
REF 29 MicroRNA-663 upregulated by oscillatory shear stress plays a role in inflammatory response of endothelial cells. Am J Physiol Heart Circ Physiol. 2011 May;300(5):H1762-9.

If You Find Any Error in Data or Bug in Web Service, Please Kindly Report It to Dr. Zhou and Dr. Zhang.