Target Regulator(s) Information (MicroRNA)

Content Navigation (  All   None )                                      
Target General Information
The microRNAs (miRNAs) Regulating This Target
References
Target General Information  Top
Target ID T28012 Target Info
Target Name Suppressor of tumorigenicity 15 protein (ST15)
Synonyms hRECK; Reversion-inducing cysteine-rich protein with Kazal motifs
Target Type Literature-reported Target
Gene Name RECK
UniProt ID
O95980
The microRNAs (miRNAs) Regulating This Target  Top
miRNA Mature ID hsa-miR-21-5p miRNA Info
miRNA Mature AC
MIMAT0000076
Sequence uagcuuaucagacugauguuga
miRNA Species Homo sapiens
Regulation Mechanism The downregulation of miR-21-5p by 2'-O-Me Antisense miRNA Oligonucleotide resulted in the changed protein level of target RECK; The overexpression by mature miRNA precursor transfection resulted in the decreased protein level of target RECK. [6]
Evidence Score (E-score) 10 +
1 Immunofluorescence; Immunohistochemistry; qRT-PCR; Western Blot [1]
2 Luciferase Reporter Assay [2]
3 Luciferase Reporter Assay; qRT-PCR; Western Blot [3]
4 Luciferase Reporter Assay; Western Blot [4]
5 Luciferase Reporter Assay; Western Blot [5]
6 Luciferase Reporter Assay; Western Blot [6]
7 qRT-PCR; Luciferase Reporter Assay; Western Blot [7]
8 qRT-PCR; Western Blot [8]
9 qRT-PCR; Western Blot [9]
10 Western Blot; qRT-PCR; Luciferase Reporter Assay [10]
Representative Target(s) Regulated by This miRNA Apoptosis antigen ligand (CD178) Target Info
TNFL6_HUMAN
Apoptosis regulator Bcl-2 (BCL-2) Target Info
BCL2_HUMAN
miRNA Mature ID hsa-miR-182-5p miRNA Info
miRNA Mature AC
MIMAT0000259
Sequence uuuggcaaugguagaacucacacu
miRNA Species Homo sapiens
Evidence Score (E-score) 5 +
1 Luciferase Reporter Assay [11]
2 Luciferase Reporter Assay [12]
3 Luciferase Reporter Assay; qRT-PCR; Western Blot [13]
4 PAR-CLIP [14]
5 qRT-PCR; Western Blot [15]
Representative Target(s) Regulated by This miRNA Apoptosis regulator Bcl-2 (BCL-2) Target Info
BCL2_HUMAN
Brain-derived neurotrophic factor (BDNF) Target Info
BDNF_HUMAN
miRNA Mature ID hsa-miR-96-5p miRNA Info
miRNA Mature AC
MIMAT0000095
Sequence uuuggcacuagcacauuuuugcu
miRNA Species Homo sapiens
Evidence Score (E-score) 3 +
1 Luciferase Reporter Assay; qRT-PCR; Western Blot [16]
2 PAR-CLIP [14]
3 qRT-PCR; Western Blot [15]
Representative Target(s) Regulated by This miRNA 5-HT 1B receptor (HTR1B) Target Info
5HT1B_HUMAN
ALK tyrosine kinase receptor (ALK) Target Info
ALK_HUMAN
miRNA Mature ID hsa-miR-15a-5p miRNA Info
miRNA Mature AC
MIMAT0000068
Sequence uagcagcacauaaugguuugug
miRNA Species Homo sapiens
Evidence Score (E-score) 2 +
1 GFP Reporter Assay; qRT-PCR [17]
2 PAR-CLIP [14]
Representative Target(s) Regulated by This miRNA Amyloid beta A4 protein (APP) Target Info
A4_HUMAN
Apoptosis regulator Bcl-2 (BCL-2) Target Info
BCL2_HUMAN
miRNA Mature ID hsa-miR-15b-5p miRNA Info
miRNA Mature AC
MIMAT0000417
Sequence uagcagcacaucaugguuuaca
miRNA Species Homo sapiens
Regulation Mechanism The overexpression of miR-15b-5p by mature miRNA precursor transfection resulted in the decreased protein level of target RECK. [6]
Evidence Score (E-score) 2 +
1 Western Blot; qRT-PCR; Luciferase Reporter Assay [10]
2 Western Blot; qRT-PCR; Luciferase Reporter Assay [6]
Representative Target(s) Regulated by This miRNA Apoptosis regulator Bcl-2 (BCL-2) Target Info
BCL2_HUMAN
Checkpoint kinase-1 (CHK1) Target Info
CHK1_HUMAN
miRNA Mature ID hsa-miR-221-3p miRNA Info
miRNA Mature AC
MIMAT0000278
Sequence agcuacauugucugcuggguuuc
miRNA Species Homo sapiens
Regulation Mechanism RECK is a direct target of miR-221. [19]
Evidence Score (E-score) 2 +
1 Luciferase Reporter Assay; qRT-PCR; Western Blot [18]
2 Luciferase Reporter Assay; Western Blot [19]
Representative Target(s) Regulated by This miRNA Bcl-2-binding component 3 (BBC3) Target Info
BBC3_HUMAN
Beclin-1 (BECN1) Target Info
BECN1_HUMAN
miRNA Mature ID hsa-miR-222-3p miRNA Info
miRNA Mature AC
MIMAT0000279
Sequence agcuacaucuggcuacugggu
miRNA Species Homo sapiens
Regulation Mechanism miR-222 can bind the sequence of RECK 3'UTR, thereby modulating its expression. [18]
Evidence Score (E-score) 2 +
1 Luciferase Reporter Assay [20]
2 Luciferase Reporter Assay; Western Blot [18]
Representative Target(s) Regulated by This miRNA AN1-type zinc finger protein 5 (ZFAND5) Target Info
ZFAN5_HUMAN
ATP-binding cassette transporter G2 (ABCG2) Target Info
ABCG2_HUMAN
miRNA Mature ID hsa-miR-373-3p miRNA Info
miRNA Mature AC
MIMAT0000726
Sequence gaagugcuucgauuuuggggugu
miRNA Species Homo sapiens
Regulation Mechanism The overexpression of miR-373-3p by mature miRNA precursor transfection resulted in the decreased protein level of target RECK. [6]
Evidence Score (E-score) 2 +
1 Western Blot; qRT-PCR; Luciferase Reporter Assay [10]
2 Western Blot; qRT-PCR; Luciferase Reporter Assay [6]
Representative Target(s) Regulated by This miRNA B-cell translocation gene 1 protein (BTG1) Target Info
BTG1_HUMAN
Cell surface protein HB15 (CD83) Target Info
CD83_HUMAN
miRNA Mature ID hsa-miR-92b-3p miRNA Info
miRNA Mature AC
MIMAT0003218
Sequence uauugcacucgucccggccucc
miRNA Species Homo sapiens
Regulation Mechanism miR-92b might promote NSCLC cell growth and motility partially by inhibiting RECK. [21]
Evidence Score (E-score) 2 +
1 Luciferase Reporter Assay [21]
2 Luciferase Reporter Assay; Western Blot [22]
Representative Target(s) Regulated by This miRNA CDK inhibitor 1C p57Kip2 (CDKN1C) Target Info
CDN1C_HUMAN
Dickkopf-related protein 3 (DKK3) Target Info
DKK3_HUMAN
miRNA Mature ID hsa-miR-135b-5p miRNA Info
miRNA Mature AC
MIMAT0000758
Sequence uauggcuuuucauuccuauguga
miRNA Species Homo sapiens
Regulation Mechanism miR-135b directly regulats RECK by binding its 3'UTR. [23]
Evidence Score (E-score) 1 +
1 Western Blot; Luciferase Reporter Assay [23]
Representative Target(s) Regulated by This miRNA Activin receptor type IB (ACVR1B) Target Info
ACV1B_HUMAN
Bone morphogenetic protein receptor (BMPR2) Target Info
BMPR2_HUMAN
miRNA Mature ID hsa-miR-16-5p miRNA Info
miRNA Mature AC
MIMAT0000069
Sequence uagcagcacguaaauauuggcg
miRNA Species Homo sapiens
Regulation Mechanism The overexpression of miR-16-5p by mature miRNA precursor transfection resulted in the decreased protein level of target RECK. [6]
Evidence Score (E-score) 1 +
1 Western Blot; Luciferase Reporter Assay; qRT-PCR [6]
Representative Target(s) Regulated by This miRNA Apoptosis regulator Bcl-2 (BCL-2) Target Info
BCL2_HUMAN
Corticotropin-releasing factor binding protein (CRHBP) Target Info
CRHBP_HUMAN
miRNA Mature ID hsa-miR-183-5p miRNA Info
miRNA Mature AC
MIMAT0000261
Sequence uauggcacugguagaauucacu
miRNA Species Homo sapiens
Evidence Score (E-score) 1 +
1 qRT-PCR; Western Blot [15]
Representative Target(s) Regulated by This miRNA Dickkopf-related protein 3 (DKK3) Target Info
DKK3_HUMAN
Early growth response protein 1 (EGR-1) Target Info
EGR1_HUMAN
miRNA Mature ID hsa-miR-25-3p miRNA Info
miRNA Mature AC
MIMAT0000081
Sequence cauugcacuugucucggucuga
miRNA Species Homo sapiens
Regulation Mechanism miR-25 promotes gastric cancer cells growth and motility partially by targeting RECK. [24]
Evidence Score (E-score) 1 +
1 Luciferase Reporter Assay; Western Blot [24]
Representative Target(s) Regulated by This miRNA CDK inhibitor 1C p57Kip2 (CDKN1C) Target Info
CDN1C_HUMAN
Cellular tumor antigen p53 (TP53) Target Info
P53_HUMAN
miRNA Mature ID hsa-miR-372-3p miRNA Info
miRNA Mature AC
MIMAT0000724
Sequence aaagugcugcgacauuugagcgu
miRNA Species Homo sapiens
Regulation Mechanism The overexpression of miR-372-3p by mature miRNA precursor transfection resulted in the decreased protein level of target RECK. [6]
Evidence Score (E-score) 1 +
1 Western Blot; qRT-PCR; Luciferase Reporter Assay [6]
Representative Target(s) Regulated by This miRNA ATPase family AAA domain containing 2 (ATAD2) Target Info
ATAD2_HUMAN
B-cell translocation gene 1 protein (BTG1) Target Info
BTG1_HUMAN
miRNA Mature ID hsa-miR-409-3p miRNA Info
miRNA Mature AC
MIMAT0001639
Sequence gaauguugcucggugaaccccu
miRNA Species Homo sapiens
Evidence Score (E-score) 1 +
1 Luciferase Reporter Assay [25]
Representative Target(s) Regulated by This miRNA Angiogenin (ANG) Target Info
ANGI_HUMAN
Fibrinogen (FGG) Target Info
FIBG_HUMAN
miRNA Mature ID hsa-miR-497-5p miRNA Info
miRNA Mature AC
MIMAT0002820
Sequence cagcagcacacugugguuugu
miRNA Species Homo sapiens
Regulation Mechanism miR-497-5p regulates the di erentiation of LR-MSCs by targeting Reck. [26]
Evidence Score (E-score) 1 +
1 Luciferase Reporter Assay [26]
Representative Target(s) Regulated by This miRNA Angiomotin (AMOT) Target Info
AMOT_HUMAN
Apoptosis inhibitor survivin (BIRC5) Target Info
BIRC5_HUMAN
miRNA Mature ID hsa-miR-590-5p miRNA Info
miRNA Mature AC
MIMAT0003258
Sequence gagcuuauucauaaaagugcag
miRNA Species Homo sapiens
Regulation Mechanism RECK is a target of miR-590-5p and miR-590-5p/RECK/AKT axis contributes to gastric cancer and may serve as a promising therapeutic target for treatment. [27]
Evidence Score (E-score) 1 +
1 Luciferase Reporter Assay; Western Blot [27]
Representative Target(s) Regulated by This miRNA Cyclic-AMP-dependent transcription factor ATF-3 (ATF3) Target Info
ATF3_HUMAN
Lectin-like oxidized LDL receptor (OLR1) Target Info
OLR1_HUMAN
miRNA Mature ID hsa-miR-15b-3p miRNA Info
miRNA Mature AC
MIMAT0004586
Sequence cgaaucauuauuugcugcucua
miRNA Species Homo sapiens
Regulation Mechanism miR-15b negatively regulates RECK expression by binding to the 3'UTR in LYO. [28]
Evidence Score (E-score) 1 +
1 Western Blot [28]
Representative Target(s) Regulated by This miRNA Cyclin D (CCND3) Target Info
CCND3_HUMAN
Insulin-like growth factor I receptor (IGF1R) Target Info
IGF1R_HUMAN
miRNA Mature ID hsa-miR-374b-5p miRNA Info
miRNA Mature AC
MIMAT0004955
Sequence auauaauacaaccugcuaagug
miRNA Species Homo sapiens
Regulation Mechanism Upregulation of miR-374b-5p contributes to gastric cancer cell metastasis and invasion through inhibition of RECK expression. [29]
Evidence Score (E-score) 1 +
1 Luciferase Reporter Assay; Western Blot [29]
Representative Target(s) Regulated by This miRNA RAC-alpha serine/threonine-protein kinase (AKT1) Target Info
AKT1_HUMAN
Suppressor of tumorigenicity 15 protein (ST15) Target Info
RECK_HUMAN
References  Top
REF 1 AC1MMYR2, an inhibitor of dicer-mediated biogenesis of Oncomir miR-21, reverses epithelial-mesenchymal transition and suppresses tumor growth and progression. Cancer Res. 2013 Sep 1;73(17):5519-31.
REF 2 MicroRNA-21 expression is regulated by -catenin/STAT3 pathway and promotes glioma cell invasion by direct targeting RECK. CNS Neurosci Ther. 2012 Jul;18(7):573-83.
REF 3 MicroRNA-21 is involved in osteosarcoma cell invasion and migration. Med Oncol. 2011 Dec;28(4):1469-74.
REF 4 MicroRNA-21 regulates the migration and invasion of a stem-like population in hepatocellular carcinoma. Int J Oncol. 2013 Aug;43(2):661-9.
REF 5 MiR-21 down-regulation suppresses cell growth, invasion and induces cell apoptosis by targeting FASL, TIMP3, and RECK genes in esophageal carcinoma. Dig Dis Sci. 2013 Jul;58(7):1863-70.
REF 6 MicroRNA 21 promotes glioma invasion by targeting matrix metalloproteinase regulators. Mol Cell Biol. 2008 Sep;28(17):5369-80.
REF 7 miR-21 plays a pivotal role in gastric cancer pathogenesis and progression. Lab Invest. 2008 Dec;88(12):1358-66.
REF 8 Lipid Nanoparticles Composed of Quaternary Amine-Tertiary Amine Cationic Lipid Combination (QTsome) for Therapeutic Delivery of AntimiR-21 for Lung Cancer. Mol Pharm. 2016 Feb 1;13(2):653-62.
REF 9 MicroRNA-21 is a unique signature associated with coronary plaque instability in humans by regulating matrix metalloproteinase-9 via reversion-inducing cysteine-rich protein with Kazal motifs. Exp Mol Pathol. 2014 Apr;96(2):242-9.
REF 10 Hypoxia and RAS-signaling pathways converge on, and cooperatively downregulate, the RECK tumor-suppressor protein through microRNAs. Oncogene. 2010 May 6;29(18):2638-48.
REF 11 MicroRNA-182-5p promotes cell invasion and proliferation by down regulating FOXF2, RECK and MTSS1 genes in human prostate cancer. PLoS One. 2013;8(1):e55502.
REF 12 Oncogenic miRNA-182-5p targets Smad4 and RECK in human bladder cancer. PLoS One. 2012;7(11):e51056.
REF 13 Up-regulation of miR-182 by -catenin in breast cancer increases tumorigenicity and invasiveness by targeting the matrix metalloproteinase inhibitor RECK. Biochim Biophys Acta. 2013 Apr;1830(4):3067-76.
REF 14 A quantitative analysis of CLIP methods for identifying binding sites of RNA-binding proteins. Nat Methods. 2011 May 15;8(7):559-64.
REF 15 MicroRNA miR-182 cluster mediated modulation of RECK without changes in cell surface membrane type-1 matrix metalloproteinase (MT1-MMP). Am J Cancer Res. 2015 Aug 15;5(9):2918-28.
REF 16 miR-96 promotes tumor proliferation and invasion by targeting RECK in breast cancer. Oncol Rep. 2014 Mar;31(3):1357-63.
REF 17 MicroRNA-15a promotes neuroblastoma migration by targeting reversion-inducing cysteine-rich protein with Kazal motifs (RECK) and regulating matrix metalloproteinase-9 expression. FEBS J. 2013 Feb;280(3):855-66.
REF 18 miR-221 and miR-222 Simultaneously Target RECK and Regulate Growth and Invasion of Gastric Cancer Cells. Med Sci Monit. 2015 Sep 13;21:2718-25.
REF 19 MicroRNA-221 promotes colorectal cancer cell invasion and metastasis by targeting RECK. FEBS Lett. 2014 Jan 3;588(1):99-104.
REF 20 Increased miR-222 in H. pylori-associated gastric cancer correlated with tumor progression by promoting cancer cell proliferation and targeting RECK. FEBS Lett. 2012 Mar 23;586(6):722-8.
REF 21 Inhibition of miR-92b suppresses nonsmall cell lung cancer cells growth and motility by targeting RECK. Mol Cell Biochem. 2014 Feb;387(1-2):171-6.
REF 22 Promotion of tumour proliferation, migration and invasion by miR-92b in targeting RECK in osteosarcoma. Clin Sci (Lond). 2016 Jun 1;130(11):921-30.
REF 23 MicroRNA-135b, a HSF1 target, promotes tumor invasion and metastasis by regulating RECK and EVI5 in hepatocellular carcinoma. Oncotarget. 2015 Feb 10;6(4):2421-33.
REF 24 MiR-25 promotes gastric cancer cells growth and motility by targeting RECK. Mol Cell Biochem. 2014 Jan;385(1-2):207-13.
REF 25 MicroRNA-130a regulates cell malignancy by targeting RECK in chronic myeloid leukemia. Am J Transl Res. 2016 Feb 15;8(2):955-67.
REF 26 The role of miR-497-5p in myofibroblast differentiation of LR-MSCs and pulmonary fibrogenesis. Sci Rep. 2017 Jan 18;7:40958.
REF 27 miR-590-5p regulates gastric cancer cell growth and chemosensitivity through RECK and the AKT/ERK pathway. Onco Targets Ther. 2016 Oct 3;9:6009-6019.
REF 28 MicroRNA-15b regulates reversion-inducing cysteine-rich protein with Kazal motifs (RECK) expression in human uterine leiomyoma. Reprod Biol Endocrinol. 2016 Aug 17;14(1):45.
REF 29 MiR-374b-5p suppresses RECK expression and promotes gastric cancer cell invasion and metastasis. World J Gastroenterol. 2014 Dec 14;20(46):17439-47.

If You Find Any Error in Data or Bug in Web Service, Please Kindly Report It to Dr. Zhou and Dr. Zhang.