Target Regulator(s) Information (MicroRNA)

Content Navigation (  All   None )                                      
Target General Information
The microRNAs (miRNAs) Regulating This Target
References
Target General Information  Top
Target ID T40474 Target Info
Target Name Proto-oncogene c-Met (MET)
Synonyms Tyrosine-protein kinase Met; Scatter factor receptor; SF receptor; Met proto-oncogene tyrosine kinase; Hepatocyte growth factor receptor; HGF/SF receptor; HGF-SF receptor; HGF receptor; C-met; C-Met receptor tyrosine kinase
Target Type Successful Target
Gene Name MET
Biochemical Class Kinase
UniProt ID
P08581
The microRNAs (miRNAs) Regulating This Target  Top
miRNA Mature ID hsa-miR-34a-5p miRNA Info
miRNA Mature AC
MIMAT0000255
Sequence uggcagugucuuagcugguugu
miRNA Species Homo sapiens
Regulation Mechanism The overexpression of miR-34a-5p by mature miRNA precursor transfection resulted in the decreased protein level of target MET. [9]
Evidence Score (E-score) 15 +
1 ELISA; Luciferase Reporter Assay; qRT-PCR [1]
2 Immunoblot; qRT-PCR [2]
3 Immunofluorescence; In Situ Hybridization; qRT-PCR; Western Blot [3]
4 Immunofluorescence; qRT-PCR; Western Blot [4]
5 Immunohistochemistry; qRT-PCR; Western Blot [5]
6 Luciferase Reporter Assay [6]
7 Luciferase Reporter Assay [7]
8 Luciferase Reporter Assay [8]
9 Luciferase Reporter Assay [9]
10 Luciferase Reporter Assay; qRT-PCR; Western Blot [10]
11 Luciferase Reporter Assay; qRT-PCR; Western Blot [11]
12 Luciferase Reporter Assay; qRT-PCR; Western Blot [12]
13 Luciferase Reporter Assay; Western Blot; Northern Blot [13]
14 qRT-PCR; Western Blot [14]
15 qRT-PCR; Western Blot [15]
Representative Target(s) Regulated by This miRNA Amphiregulin (AREG) Target Info
AREG_HUMAN
Androgen receptor (AR) Target Info
ANDR_HUMAN
miRNA Mature ID hsa-miR-206 miRNA Info
miRNA Mature AC
MIMAT0000462
Sequence uggaauguaaggaagugugugg
miRNA Species Homo sapiens
Evidence Score (E-score) 5 +
1 Immunohistochemistry; qRT-PCR; Western Blot [16]
2 Immunohistochemistry; qRT-PCR; Western Blot [9]
3 Luciferase Reporter Assay; Western Blot [17]
4 qRT-PCR; ChIP; Luciferase Reporter Assay; Western Blot; Northern Blot [18]
5 Western Blot [19]
Representative Target(s) Regulated by This miRNA Annexin A2 (ANXA2) Target Info
ANXA2_HUMAN
Apoptosis regulator Bcl-2 (BCL-2) Target Info
BCL2_HUMAN
miRNA Mature ID hsa-miR-34c-5p miRNA Info
miRNA Mature AC
MIMAT0000686
Sequence aggcaguguaguuagcugauugc
miRNA Species Homo sapiens
Regulation Mechanism Met is inhibited by miR-34 at the translational level. [7]
Evidence Score (E-score) 5 +
1 Luciferase Reporter Assay [20]
2 Luciferase Reporter Assay [21]
3 Luciferase Reporter Assay [22]
4 Luciferase Reporter Assay [7]
5 Microarray; Western Blot; RT-PCR [23]
Representative Target(s) Regulated by This miRNA Apoptosis regulator Bcl-2 (BCL-2) Target Info
BCL2_HUMAN
Cyclin-dependent kinase 4 (CDK4) Target Info
CDK4_HUMAN
miRNA Mature ID hsa-miR-23b-3p miRNA Info
miRNA Mature AC
MIMAT0000418
Sequence aucacauugccagggauuacc
miRNA Species Homo sapiens
Regulation Mechanism The overexpression of miR-23b-3p by mature miRNA mimics tranfection resulted in the decreased protein level of target MET. [9]
Evidence Score (E-score) 4 +
1 Luciferase Reporter Assay; qRT-PCR; Western Blot [24]
2 Luciferase Reporter Assay; qRT-PCR; Western Blot [25]
3 Luciferase Reporter Assay; qRT-PCR; Western Blot [9]
4 qRT-PCR; Luciferase Reporter Assay; Western Blot [26]
Representative Target(s) Regulated by This miRNA Activin receptor type IIB (ACVR2B) Target Info
AVR2B_HUMAN
Carbonic anhydrase II (CA-II) Target Info
CAH2_HUMAN
miRNA Mature ID hsa-miR-449a miRNA Info
miRNA Mature AC
MIMAT0001541
Sequence uggcaguguauuguuagcuggu
miRNA Species Homo sapiens
Regulation Mechanism Direct interaction of miR-449 with the target gene MET 3'UTR was confirmed. [28]
Evidence Score (E-score) 3 +
1 Luciferase Reporter Assay; qRT-PCR; Western Blot [27]
2 Luciferase Reporter Assay; Western Blot [28]
3 Luciferase Reporter Assay; Western Blot; qRT-PCR [29]
Representative Target(s) Regulated by This miRNA Apoptosis regulator Bcl-2 (BCL-2) Target Info
BCL2_HUMAN
Cyclin-dependent kinase 4 (CDK4) Target Info
CDK4_HUMAN
miRNA Mature ID hsa-miR-31-5p miRNA Info
miRNA Mature AC
MIMAT0000089
Sequence aggcaagaugcuggcauagcu
miRNA Species Homo sapiens
Regulation Mechanism miR-31 targets melanoma oncogenes MET. [30]
Evidence Score (E-score) 3 +
1 Immunoblot; Immunohistochemistry; Luciferase Reporter Assay [30]
2 Luciferase Reporter Assay [31]
3 Luciferase Reporter Assay [32]
Representative Target(s) Regulated by This miRNA Cyclin-dependent kinase 1 (CDK1) Target Info
CDK1_HUMAN
Dickkopf-related protein 1 (DKK1) Target Info
DKK1_HUMAN
miRNA Mature ID hsa-miR-133b miRNA Info
miRNA Mature AC
MIMAT0000770
Sequence uuugguccccuucaaccagcua
miRNA Species Homo sapiens
Regulation Mechanism Overexpression of miR-133b decreased the expression of MET. [33]
Evidence Score (E-score) 2 +
1 Reporter Assay [33]
2 Western Blot [34]
Representative Target(s) Regulated by This miRNA Apoptosis mediating surface antigen FAS (FAS) Target Info
TNR6_HUMAN
Apoptosis regulator Bcl-W (BCL-W) Target Info
B2CL2_HUMAN
miRNA Mature ID hsa-miR-144-3p miRNA Info
miRNA Mature AC
MIMAT0000436
Sequence uacaguauagaugauguacu
miRNA Species Homo sapiens
Regulation Mechanism miR-144 suppresses gastric cancer progression by directly downregulating MET expression. [36]
Evidence Score (E-score) 2 +
1 Luciferase Reporter Assay; qRT-PCR; Western Blot [35]
2 Luciferase Reporter Assay; Western Blot [36]
Representative Target(s) Regulated by This miRNA ADAM metallopeptidase with thrombospondin 1 (ADAMTS1) Target Info
ATS1_HUMAN
Amyloid beta A4 protein (APP) Target Info
A4_HUMAN
miRNA Mature ID hsa-miR-144-5p miRNA Info
miRNA Mature AC
MIMAT0004600
Sequence ggauaucaucauauacuguaag
miRNA Species Homo sapiens
Evidence Score (E-score) 2 +
1 Luciferase Reporter Assay; qRT-PCR; Western Blot [37]
2 Luciferase Reporter Assay; qRT-PCR; Western Blot [9]
Representative Target(s) Regulated by This miRNA G1/S-specific cyclin-E1 (CCNE1) Target Info
CCNE1_HUMAN
G1/S-specific cyclin-E2 (CCNE2) Target Info
CCNE2_HUMAN
miRNA Mature ID hsa-miR-34b-3p miRNA Info
miRNA Mature AC
MIMAT0004676
Sequence caaucacuaacuccacugccau
miRNA Species Homo sapiens
Evidence Score (E-score) 2 +
1 Luciferase Reporter Assay [21]
2 Western Blot; RT-PCR [23]
Representative Target(s) Regulated by This miRNA Apoptosis regulator Bcl-2 (BCL-2) Target Info
BCL2_HUMAN
Cyclic AMP-responsive element-binding protein (CREB1) Target Info
CREB1_HUMAN
miRNA Mature ID hsa-miR-1-3p miRNA Info
miRNA Mature AC
MIMAT0000416
Sequence uggaauguaaagaaguauguau
miRNA Species Homo sapiens
Regulation Mechanism The overexpression of miR-1-3p by mature miRNA precursor transfection resulted in the changed mRNA level of target MET. [9]
Evidence Score (E-score) 1 +
1 Luciferase Reporter Assay [9]
Representative Target(s) Regulated by This miRNA Apoptosis regulator Bcl-2 (BCL-2) Target Info
BCL2_HUMAN
Brain-derived neurotrophic factor (BDNF) Target Info
BDNF_HUMAN
miRNA Mature ID hsa-miR-130a-3p miRNA Info
miRNA Mature AC
MIMAT0000425
Sequence cagugcaauguuaaaagggcau
miRNA Species Homo sapiens
Evidence Score (E-score) 1 +
1 qRT-PCR [38]
Representative Target(s) Regulated by This miRNA Activin receptor-like kinase 2 (ALK-2) Target Info
ACVR1_HUMAN
Amyloid beta A4 protein (APP) Target Info
A4_HUMAN
miRNA Mature ID hsa-miR-139-5p miRNA Info
miRNA Mature AC
MIMAT0000250
Sequence ucuacagugcacgugucuccagu
miRNA Species Homo sapiens
Regulation Mechanism Oncogene MET is a target of miR-139-5p at specific 3'UTR site. Inhibition of miR-139-5p significantly promoted c-Met expression. [39]
Evidence Score (E-score) 1 +
1 Luciferase Reporter Assay; Western Blot [39]
Representative Target(s) Regulated by This miRNA Apoptosis regulator Bcl-2 (BCL-2) Target Info
BCL2_HUMAN
C-X-C chemokine receptor type 4 (CXCR4) Target Info
CXCR4_HUMAN
miRNA Mature ID hsa-miR-148a-3p miRNA Info
miRNA Mature AC
MIMAT0000243
Sequence ucagugcacuacagaacuuugu
miRNA Species Homo sapiens
Regulation Mechanism Dual-luciferase reporter assays revealed that the restoration of miR-148a expression significantly attenuated the activity of firefly luciferase with the wild-type 3 ' -UTR of Met, whereas this effect was abrogated when the predicted 3 ' -UTR-binding site was mutated. [40]
Evidence Score (E-score) 1 +
1 Immunoblot; Immunofluorescence; Immunohistochemistry; Luciferase Reporter Assay; Western Blot [40]
Representative Target(s) Regulated by This miRNA Activated leukocyte cell adhesionmolecule (ALCAM) Target Info
CD166_HUMAN
Activin receptor-like kinase 2 (ALK-2) Target Info
ACVR1_HUMAN
miRNA Mature ID hsa-miR-198 miRNA Info
miRNA Mature AC
MIMAT0000228
Sequence gguccagaggggagauagguuc
miRNA Species Homo sapiens
Regulation Mechanism miR-198 directly binds to the 3' UTR of c-MET to regulate its expression. [41]
Evidence Score (E-score) 1 +
1 Luciferase Reporter Assay; Western Blot [41]
Representative Target(s) Regulated by This miRNA Fibroblast growth factor receptor 1 (FGFR1) Target Info
FGFR1_HUMAN
Janus kinase 3 (JAK-3) Target Info
JAK3_HUMAN
miRNA Mature ID hsa-miR-27a-3p miRNA Info
miRNA Mature AC
MIMAT0000084
Sequence uucacaguggcuaaguuccgc
miRNA Species Homo sapiens
Regulation Mechanism miR-27a Targets MET in NSCLC. [42]
Evidence Score (E-score) 1 +
1 Luciferase Reporter Assay; Western Blot [42]
Representative Target(s) Regulated by This miRNA ATP-binding cassette transporter A1 (ABCA1) Target Info
ABCA1_HUMAN
Cellular tumor antigen p53 (TP53) Target Info
P53_HUMAN
miRNA Mature ID hsa-miR-27b-3p miRNA Info
miRNA Mature AC
MIMAT0000419
Sequence uucacaguggcuaaguucugc
miRNA Species Homo sapiens
Regulation Mechanism Expression of EGFR protein was repressed in miR-27b transfectant. [26]
Evidence Score (E-score) 1 +
1 Luciferase Reporter Assay; Western Blot [26]
Representative Target(s) Regulated by This miRNA Adenosine A2b receptor (ADORA2B) Target Info
AA2BR_HUMAN
Albendazole monooxygenase (CYP3A4) Target Info
CP3A4_HUMAN
miRNA Mature ID hsa-miR-340-5p miRNA Info
miRNA Mature AC
MIMAT0004692
Sequence uuauaaagcaaugagacugauu
miRNA Species Homo sapiens
Regulation Mechanism miR-340 directly targets the c-Met gene. [43]
Evidence Score (E-score) 1 +
1 Immunohistochemistry; Luciferase Reporter Assay; Western Blot [43]
Representative Target(s) Regulated by This miRNA Cyclin-dependent kinase 6 (CDK6) Target Info
CDK6_HUMAN
G1/S-specific cyclin-D1 (CCND1) Target Info
CCND1_HUMAN
miRNA Mature ID hsa-miR-34a-3p miRNA Info
miRNA Mature AC
MIMAT0004557
Sequence caaucagcaaguauacugcccu
miRNA Species Homo sapiens
Evidence Score (E-score) 1 +
1 Western Blot [44]
Representative Target(s) Regulated by This miRNA Apoptosis regulator Bcl-2 (BCL-2) Target Info
BCL2_HUMAN
Beta-catenin (CTNNB1) Target Info
CTNB1_HUMAN
miRNA Mature ID hsa-miR-34b-5p miRNA Info
miRNA Mature AC
MIMAT0000685
Sequence uaggcagugucauuagcugauug
miRNA Species Homo sapiens
Regulation Mechanism Met is inhibited by miR-34 at the translational level. [7]
Evidence Score (E-score) 1 +
1 Luciferase Reporter Assay [7]
Representative Target(s) Regulated by This miRNA Apoptosis regulator Bcl-2 (BCL-2) Target Info
BCL2_HUMAN
Beta-catenin (CTNNB1) Target Info
CTNB1_HUMAN
miRNA Mature ID hsa-miR-409-3p miRNA Info
miRNA Mature AC
MIMAT0001639
Sequence gaauguugcucggugaaccccu
miRNA Species Homo sapiens
Regulation Mechanism miR-409-3p suppressed the expression of c-Met by binding to its 3'-untranslated region. [45]
Evidence Score (E-score) 1 +
1 Luciferase Reporter Assay; Western Blot [45]
Representative Target(s) Regulated by This miRNA Angiogenin (ANG) Target Info
ANGI_HUMAN
Fibrinogen (FGG) Target Info
FIBG_HUMAN
miRNA Mature ID hsa-miR-410-3p miRNA Info
miRNA Mature AC
MIMAT0002171
Sequence aauauaacacagauggccugu
miRNA Species Homo sapiens
Regulation Mechanism miR-410 bind to the 3'UTR of MET and impair MET mRNA translation. [46]
Evidence Score (E-score) 1 +
1 Luciferase Reporter Assay; Western Blot [46]
Representative Target(s) Regulated by This miRNA Angiotensin II receptor type-1 (AGTR1) Target Info
AGTR1_HUMAN
G2/mitotic-specific cyclin B1 (CCNB1) Target Info
CCNB1_HUMAN
miRNA Mature ID hsa-miR-433-3p miRNA Info
miRNA Mature AC
MIMAT0001627
Sequence aucaugaugggcuccucggugu
miRNA Species Homo sapiens
Regulation Mechanism c-Met is a direct target of miR-433. [47]
Evidence Score (E-score) 1 +
1 Luciferase Reporter Assay [47]
Representative Target(s) Regulated by This miRNA cAMP-dependent chloride channel (CFTR) Target Info
CFTR_HUMAN
Cyclic AMP-responsive element-binding protein (CREB1) Target Info
CREB1_HUMAN
miRNA Mature ID hsa-miR-449b-5p miRNA Info
miRNA Mature AC
MIMAT0003327
Sequence aggcaguguauuguuagcuggc
miRNA Species Homo sapiens
Regulation Mechanism Direct interaction of miR-449 with the target gene MET 3'UTR was confirmed. [28]
Evidence Score (E-score) 1 +
1 Luciferase Reporter Assay; Western Blot [28]
Representative Target(s) Regulated by This miRNA Cyclin-dependent kinase 4 (CDK4) Target Info
CDK4_HUMAN
Cyclin-dependent kinase 6 (CDK6) Target Info
CDK6_HUMAN
miRNA Mature ID hsa-miR-449c-5p miRNA Info
miRNA Mature AC
MIMAT0010251
Sequence uaggcaguguauugcuagcggcugu
miRNA Species Homo sapiens
Regulation Mechanism miR-449c target MET to suppress gastric cancer cell growth. [48]
Evidence Score (E-score) 1 +
1 Luciferase Reporter Assay; Western Blot [48]
Representative Target(s) Regulated by This miRNA Proto-oncogene c-Met (MET) Target Info
MET_HUMAN
Proto-oncogene c-Myc (MYC) Target Info
MYC_HUMAN
miRNA Mature ID hsa-miR-562 miRNA Info
miRNA Mature AC
MIMAT0003226
Sequence aaaguagcuguaccauuugc
miRNA Species Homo sapiens
Evidence Score (E-score) 1 +
1 Luciferase Reporter Assay [49]
Representative Target(s) Regulated by This miRNA Presenilin 1 (PSEN1) Target Info
PSN1_HUMAN
Proto-oncogene c-Met (MET) Target Info
MET_HUMAN
miRNA Mature ID hsa-miR-7515 miRNA Info
miRNA Mature AC
MIMAT0029310
Sequence agaagggaagauggugac
miRNA Species Homo sapiens
Evidence Score (E-score) 1 +
1 Luciferase Reporter Assay; Western Blot [50]
Representative Target(s) Regulated by This miRNA Proto-oncogene c-Met (MET) Target Info
MET_HUMAN
References  Top
REF 1 MicroRNA-34a overcomes HGF-mediated gefitinib resistance in EGFR mutant lung cancer cells partly by targeting MET. Cancer Lett. 2014 Sep 1;351(2):265-71.
REF 2 FoxO3 increases miR-34a to cause palmitate-induced cholangiocyte lipoapoptosis. J Lipid Res. 2017 May;58(5):866-875.
REF 3 Chitosan nanoparticle-mediated delivery of miRNA-34a decreases prostate tumor growth in the bone and its expression induces non-canonical autophagy. Oncotarget. 2015 Oct 6;6(30):29161-77.
REF 4 Inhibitory effect of microRNA-34a on retinal pigment epithelial cell proliferation and migration. Invest Ophthalmol Vis Sci. 2013 Oct 3;54(10):6481-8.
REF 5 MicroRNA 4a attenuates the proliferation, invasion and metastasis of gastric cancer cells via downregulation of MET. Mol Med Rep. 2015 Oct;12(4):5255-61.
REF 6 MicroRNA-34a suppresses malignant transformation by targeting c-Myc transcriptional complexes in human renal cell carcinoma. Carcinogenesis. 2012 Feb;33(2):294-300.
REF 7 The miR-34 family in cancer and apoptosis. Cell Death Differ. 2010 Feb;17(2):193-9.
REF 8 The cell growth suppressor, mir-126, targets IRS-1. Biochem Biophys Res Commun. 2008 Dec 5;377(1):136-40.
REF 9 Down-regulation of micro-RNA-1 (miR-1) in lung cancer. Suppression of tumorigenic property of lung cancer cells and their sensitization to doxorubicin-induced apoptosis by miR-1. J Biol Chem. 2008 Nov 28;283(48):33394-405.
REF 10 Upregulation of microRNA-34a enhances the DDP sensitivity of gastric cancer cells by modulating proliferation and apoptosis via targeting MET. Oncol Rep. 2016 Oct;36(4):2391-7.
REF 11 MicroRNA-34a inhibits the proliferation and metastasis of osteosarcoma cells both in vitro and in vivo. PLoS One. 2012;7(3):e33778.
REF 12 MicroRNA-34a inhibits glioblastoma growth by targeting multiple oncogenes. Cancer Res. 2009 Oct 1;69(19):7569-76.
REF 13 MicroRNA-34a inhibits uveal melanoma cell proliferation and migration through downregulation of c-Met. Invest Ophthalmol Vis Sci. 2009 Apr;50(4):1559-65.
REF 14 Prognostic significance of differentially expressed miRNAs in esophageal cancer. Int J Cancer. 2011 Jan 1;128(1):132-43.
REF 15 miR-34a inhibits migration and invasion by down-regulation of c-Met expression in human hepatocellular carcinoma cells. Cancer Lett. 2009 Mar 8;275(1):44-53.
REF 16 MicroRNA-206: Effective Inhibition of Gastric Cancer Progression through the c-Met Pathway. PLoS One. 2015 Jul 17;10(7):e0128751.
REF 17 MicroRNA-1/206 targets c-Met and inhibits rhabdomyosarcoma development. J Biol Chem. 2009 Oct 23;284(43):29596-604.
REF 18 MicroRNA cluster 221-222 and estrogen receptor alpha interactions in breast cancer. J Natl Cancer Inst. 2010 May 19;102(10):706-21.
REF 19 The muscle-specific microRNA miR-206 blocks human rhabdomyosarcoma growth in xenotransplanted mice by promoting myogenic differentiation. J Clin Invest. 2009 Aug;119(8):2366-78.
REF 20 The tumour suppressor miR-34c targets MET in prostate cancer cells. Br J Cancer. 2013 Sep 3;109(5):1271-8.
REF 21 MicroRNA-34b/c suppresses uveal melanoma cell proliferation and migration through multiple targets. Mol Vis. 2012;18:537-46.
REF 22 Hsa-miR-34c suppresses growth and invasion of human laryngeal carcinoma cells via targeting c-Met. Int J Mol Med. 2010 Apr;25(4):565-71.
REF 23 Methylation-associated silencing of microRNA-34b/c in gastric cancer and its involvement in an epigenetic field defect. Carcinogenesis. 2010 Dec;31(12):2066-73.
REF 24 Human papillomavirus type 16 E6 suppresses microRNA-23b expression in human cervical cancer cells through DNA methylation of the host gene C9orf3. Oncotarget. 2017 Feb 14;8(7):12158-12173.
REF 25 MicroRNA-23b mediates urokinase and c-met downmodulation and a decreased migration of human hepatocellular carcinoma cells. FEBS J. 2009 Jun;276(11):2966-82.
REF 26 Dual regulation of receptor tyrosine kinase genes EGFR and c-Met by the tumor-suppressive microRNA-23b/27b cluster in bladder cancer. Int J Oncol. 2015 Feb;46(2):487-96.
REF 27 MiR-449a suppresses the epithelial-mesenchymal transition and metastasis of hepatocellular carcinoma by multiple targets. BMC Cancer. 2015 Oct 15;15:706.
REF 28 miR-449 inhibits cell proliferation and is down-regulated in gastric cancer. Mol Cancer. 2011 Mar 18;10:29.
REF 29 MicroRNA-449a is downregulated in non-small cell lung cancer and inhibits migration and invasion by targeting c-Met. PLoS One. 2013 May 29;8(5):e64759.
REF 30 Genetic and epigenetic loss of microRNA-31 leads to feed-forward expression of EZH2 in melanoma. Oncotarget. 2012 Sep;3(9):1011-25.
REF 31 MicroRNA miR-24 promotes cell proliferation by targeting the CDKs inhibitors p27Kip1 and p16INK4a. J Cell Physiol. 2013 Oct;228(10):2015-23.
REF 32 Downregulation of miRNA-31 induces taxane resistance in ovarian cancer cells through increase of receptor tyrosine kinase MET. Oncogenesis. 2013 Mar 25;2:e40.
REF 33 miR-133b regulates the MET proto-oncogene and inhibits the growth of colorectal cancer cells in vitro and in vivo. Cancer Biol Ther. 2010 Jul 15;10(2):190-7.
REF 34 MiR-133b is down-regulated in human osteosarcoma and inhibits osteosarcoma cells proliferation, migration and invasion, and promotes apoptosis. PLoS One. 2013 Dec 31;8(12):e83571.
REF 35 miR-144-3p exerts anti-tumor effects in glioblastoma by targeting c-Met. J Neurochem. 2015 Oct;135(2):274-86.
REF 36 MicroRNA-144 inhibits the metastasis of gastric cancer by targeting MET expression. J Exp Clin Cancer Res. 2015 Apr 17;34:35.
REF 37 MiR-144 Inhibits Uveal Melanoma Cell Proliferation and Invasion by Regulating c-Met Expression. PLoS One. 2015 May 11;10(5):e0124428.
REF 38 MicroRNA expression profiling in HCV-infected human hepatoma cells identifies potential anti-viral targets induced by interferon-. PLoS One. 2013;8(2):e55733.
REF 39 Hsa-miR-139-5p inhibits proliferation and causes apoptosis associated with down-regulation of c-Met. Oncotarget. 2015 Nov 24;6(37):39756-92.
REF 40 MicroRNA-148a suppresses the epithelial-mesenchymal transition and metastasis of hepatoma cells by targeting Met/Snail signaling. Oncogene. 2014 Jul 31;33(31):4069-76.
REF 41 miR-198 inhibits migration and invasion of hepatocellular carcinoma cells by targeting the HGF/c-MET pathway. FEBS Lett. 2011 Jul 21;585(14):2229-34.
REF 42 Cross-talk between MET and EGFR in non-small cell lung cancer involves miR-27a and Sprouty2. Proc Natl Acad Sci U S A. 2013 May 21;110(21):8573-8.
REF 43 miR-340 inhibition of breast cancer cell migration and invasion through targeting of oncoprotein c-Met. Cancer. 2011 Jul 1;117(13):2842-52.
REF 44 Expression of transforming growth factor 1 promotes cholangiocarcinoma development and progression. Cancer Lett. 2016 Sep 28;380(1):153-62.
REF 45 MicroRNA-409-3p inhibits migration and invasion of bladder cancer cells via targeting c-Met. Mol Cells. 2013 Jul;36(1):62-8.
REF 46 MiR-410 regulates MET to influence the proliferation and invasion of glioma. Int J Biochem Cell Biol. 2012 Nov;44(11):1711-7.
REF 47 c-Met and CREB1 are involved in miR-433-mediated inhibition of the epithelial-mesenchymal transition in bladder cancer by regulating Akt/GSK-3/Snail signaling. Cell Death Dis. 2016 Feb 4;7:e2088.
REF 48 MiR-449c inhibits gastric carcinoma growth. Life Sci. 2015 Sep 15;137:14-9.
REF 49 Loss of heterozygosity at 2q37 in sporadic Wilms' tumor: putative role for miR-562. Clin Cancer Res. 2009 Oct 1;15(19):5985-92.
REF 50 The novel miR-7515 decreases the proliferation and migration of human lung cancer cells by targeting c-Met. Mol Cancer Res. 2013 Jan;11(1):43-53.

If You Find Any Error in Data or Bug in Web Service, Please Kindly Report It to Dr. Zhou and Dr. Zhang.