Target Regulator(s) Information (MicroRNA)

Content Navigation (  All   None )                                      
Target General Information
The microRNAs (miRNAs) Regulating This Target
References
Target General Information  Top
Target ID T72850 Target Info
Target Name Forkhead box protein O1A (FOXO1)
Synonyms Forkhead in rhabdomyosarcoma; Forkhead box protein O1; FOXO1A; FKHR
Target Type Literature-reported Target
Gene Name FOXO1
UniProt ID
Q12778
The microRNAs (miRNAs) Regulating This Target  Top
miRNA Mature ID hsa-miR-27a-3p miRNA Info
miRNA Mature AC
MIMAT0000084
Sequence uucacaguggcuaaguuccgc
miRNA Species Homo sapiens
Regulation Mechanism The overexpression of miR-27a-3p by mature miRNA mimics tranfection resulted in the decreased protein level of target FOXO1. [2]
Evidence Score (E-score) 4 +
1 Immunohistochemistry; In Situ Hybridization; Microarray; qRT-PCR [1]
2 Immunohistochemistry; In Situ Hybridization; Microarray; qRT-PCR [2]
3 Immunohistochemistry; Northern Blot; qRT-PCR; Western Blot [3]
4 Immunohistochemistry; qRT-PCR; Western Blot [4]
Representative Target(s) Regulated by This miRNA ATP-binding cassette transporter A1 (ABCA1) Target Info
ABCA1_HUMAN
Cellular tumor antigen p53 (TP53) Target Info
P53_HUMAN
miRNA Mature ID hsa-miR-96-5p miRNA Info
miRNA Mature AC
MIMAT0000095
Sequence uuuggcacuagcacauuuuugcu
miRNA Species Homo sapiens
Regulation Mechanism The overexpression of miR-96-5p by mature miRNA mimics tranfection resulted in the decreased protein level of target FOXO1. [2]
Evidence Score (E-score) 4 +
1 Immunohistochemistry; Northern Blot; qRT-PCR; Western Blot [3]
2 Luciferase Reporter Assay; qRT-PCR; Western Blot [5]
3 Luciferase Reporter Assay; qRT-PCR; Western Blot [6]
4 Luciferase Reporter Assay; qRT-PCR; Western Blot [2]
Representative Target(s) Regulated by This miRNA 5-HT 1B receptor (HTR1B) Target Info
5HT1B_HUMAN
ALK tyrosine kinase receptor (ALK) Target Info
ALK_HUMAN
miRNA Mature ID hsa-miR-183-5p miRNA Info
miRNA Mature AC
MIMAT0000261
Sequence uauggcacugguagaauucacu
miRNA Species Homo sapiens
Regulation Mechanism The overexpression of miR-183-5p by mature miRNA mimics tranfection resulted in the decreased protein level of target FOXO1. [2]
Evidence Score (E-score) 3 +
1 Immunohistochemistry; Northern Blot; qRT-PCR; Western Blot [3]
2 Immunohistochemistry; Northern Blot; qRT-PCR; Western Blot [2]
3 Luciferase Reporter Assay; qRT-PCR; Western Blot [7]
Representative Target(s) Regulated by This miRNA Dickkopf-related protein 3 (DKK3) Target Info
DKK3_HUMAN
Early growth response protein 1 (EGR-1) Target Info
EGR1_HUMAN
miRNA Mature ID hsa-miR-132-3p miRNA Info
miRNA Mature AC
MIMAT0000426
Sequence uaacagucuacagccauggucg
miRNA Species Homo sapiens
Regulation Mechanism miR-132 upregulation in gastric cancer cells may promote cell growth through suppression of Foxo1 translation. [9]
Evidence Score (E-score) 2 +
1 Luciferase Reporter Assay; Western Blot [8]
2 Luciferase Reporter Assay; Western Blot [9]
Representative Target(s) Regulated by This miRNA Brain-derived neurotrophic factor (BDNF) Target Info
BDNF_HUMAN
Cyclin A2 (CCNA2) Target Info
CCNA2_HUMAN
miRNA Mature ID hsa-miR-15b-5p miRNA Info
miRNA Mature AC
MIMAT0000417
Sequence uagcagcacaucaugguuuaca
miRNA Species Homo sapiens
Evidence Score (E-score) 2 +
1 HITS-CLIP [10]
2 Luciferase Reporter Assay; qRT-PCR; Western Blot [11]
Representative Target(s) Regulated by This miRNA Apoptosis regulator Bcl-2 (BCL-2) Target Info
BCL2_HUMAN
Checkpoint kinase-1 (CHK1) Target Info
CHK1_HUMAN
miRNA Mature ID hsa-miR-182-5p miRNA Info
miRNA Mature AC
MIMAT0000259
Sequence uuuggcaaugguagaacucacacu
miRNA Species Homo sapiens
Regulation Mechanism Endogenous FOXO1 protein levels were increased by up to 3-fold in a dose-dependent manner upon knockdown of miR-182, indicating that these microRNAs coordinately regulate the expression of endogenous FOXO1. [2]
Evidence Score (E-score) 2 +
1 Immunohistochemistry; Microarray; qRT-PCR [12]
2 Luciferase Reporter Assay; Western Blot [2]
Representative Target(s) Regulated by This miRNA Apoptosis regulator Bcl-2 (BCL-2) Target Info
BCL2_HUMAN
Brain-derived neurotrophic factor (BDNF) Target Info
BDNF_HUMAN
miRNA Mature ID hsa-miR-186-5p miRNA Info
miRNA Mature AC
MIMAT0000456
Sequence caaagaauucuccuuuugggcu
miRNA Species Homo sapiens
Regulation Mechanism The overexpression of miR-186-5p by mature miRNA mimics tranfection resulted in the decreased protein level of target FOXO1. [2]
Evidence Score (E-score) 2 +
1 Immunohistochemistry; Northern Blot; qRT-PCR; Western Blot [3]
2 Immunohistochemistry; Northern Blot; qRT-PCR; Western Blot [2]
Representative Target(s) Regulated by This miRNA Casein kinase II alpha (CSNK2A1) Target Info
CSK21_HUMAN
Fibroblast growth factor-2 (FGF2) Target Info
FGF2_HUMAN
miRNA Mature ID hsa-miR-223-3p miRNA Info
miRNA Mature AC
MIMAT0000280
Sequence ugucaguuugucaaauacccca
miRNA Species Homo sapiens
Regulation Mechanism miR-223 could really target FOXO1 mRNA which led to reduction of cytoplasmic FOXO1 protein. [14]
Evidence Score (E-score) 2 +
1 Luciferase Reporter Assay [13]
2 Luciferase Reporter Assay; Western Blot [14]
Representative Target(s) Regulated by This miRNA ATM serine/threonine kinase (ATM) Target Info
ATM_HUMAN
C-X-C motif chemokine 2 (CXCL2) Target Info
CXCL2_HUMAN
miRNA Mature ID hsa-miR-27b-3p miRNA Info
miRNA Mature AC
MIMAT0000419
Sequence uucacaguggcuaaguucugc
miRNA Species Homo sapiens
Regulation Mechanism Overexpression of miR-27b decreased FOXO1 expression and inhibition of miR-27b increased FOXO1 expression. [15]
Evidence Score (E-score) 2 +
1 Immunohistochemistry; In Situ Hybridization; Microarray; qRT-PCR [1]
2 qRT-PCR; Western Blot [15]
Representative Target(s) Regulated by This miRNA Adenosine A2b receptor (ADORA2B) Target Info
AA2BR_HUMAN
Albendazole monooxygenase (CYP3A4) Target Info
CP3A4_HUMAN
miRNA Mature ID hsa-miR-370-3p miRNA Info
miRNA Mature AC
MIMAT0000722
Sequence gccugcugggguggaaccuggu
miRNA Species Homo sapiens
Regulation Mechanism miR-370 directly targets the transcription factor FOXO1 in prostate cancer cells. [17]
Evidence Score (E-score) 2 +
1 Luciferase Reporter Assay; qRT-PCR; Western Blot [16]
2 Luciferase Reporter Assay; Western Blot [17]
Representative Target(s) Regulated by This miRNA Beta-catenin (CTNNB1) Target Info
CTNB1_HUMAN
Forkhead box protein M1 (FOXM1) Target Info
FOXM1_HUMAN
miRNA Mature ID hsa-miR-107 miRNA Info
miRNA Mature AC
MIMAT0000104
Sequence agcagcauuguacagggcuauca
miRNA Species Homo sapiens
Regulation Mechanism The expression of FOXO1 was negatively regulated by miR-107. [18]
Evidence Score (E-score) 1 +
1 Luciferase Reporter Assay; Western Blot [18]
Representative Target(s) Regulated by This miRNA Beta-secretase 1 (BACE1) Target Info
BACE1_HUMAN
Caveolin 1 (CAV1) Target Info
CAV1_HUMAN
miRNA Mature ID hsa-miR-135b-5p miRNA Info
miRNA Mature AC
MIMAT0000758
Sequence uauggcuuuucauuccuauguga
miRNA Species Homo sapiens
Regulation Mechanism FOXO1 is a direct target of miR-135b. [19]
Evidence Score (E-score) 1 +
1 Luciferase Reporter Assay; Western Blot [19]
Representative Target(s) Regulated by This miRNA Activin receptor type IB (ACVR1B) Target Info
ACV1B_HUMAN
Bone morphogenetic protein receptor (BMPR2) Target Info
BMPR2_HUMAN
miRNA Mature ID hsa-miR-15a-5p miRNA Info
miRNA Mature AC
MIMAT0000068
Sequence uagcagcacauaaugguuugug
miRNA Species Homo sapiens
Regulation Mechanism FoxO1 is a target gene of miR-15a. [11]
Evidence Score (E-score) 1 +
1 Luciferase Reporter Assay; Western Blot [11]
Representative Target(s) Regulated by This miRNA Amyloid beta A4 protein (APP) Target Info
A4_HUMAN
Apoptosis regulator Bcl-2 (BCL-2) Target Info
BCL2_HUMAN
miRNA Mature ID hsa-miR-200c-3p miRNA Info
miRNA Mature AC
MIMAT0000617
Sequence uaauacugccggguaaugaugga
miRNA Species Homo sapiens
Regulation Mechanism FOXO1 is a miR-200c target and miR-200c binds on its 3'UTR. [20]
Evidence Score (E-score) 1 +
1 Luciferase Reporter Assay; Western Blot [20]
Representative Target(s) Regulated by This miRNA Activin receptor type IIB (ACVR2B) Target Info
AVR2B_HUMAN
Apoptosis regulator Bcl-2 (BCL-2) Target Info
BCL2_HUMAN
miRNA Mature ID hsa-miR-21-5p miRNA Info
miRNA Mature AC
MIMAT0000076
Sequence uagcuuaucagacugauguuga
miRNA Species Homo sapiens
Regulation Mechanism FOXO1 is directly targeted by miR-21. [21]
Evidence Score (E-score) 1 +
1 Luciferase Reporter Assay; Western Blot [21]
Representative Target(s) Regulated by This miRNA Apoptosis antigen ligand (CD178) Target Info
TNFL6_HUMAN
Apoptosis regulator Bcl-2 (BCL-2) Target Info
BCL2_HUMAN
miRNA Mature ID hsa-miR-222-3p miRNA Info
miRNA Mature AC
MIMAT0000279
Sequence agcuacaucuggcuacugggu
miRNA Species Homo sapiens
Regulation Mechanism miR-222 expression was negatively correlated with FOXO1 expression. [22]
Evidence Score (E-score) 1 +
1 qRT-PCR; Western Blot [22]
Representative Target(s) Regulated by This miRNA AN1-type zinc finger protein 5 (ZFAND5) Target Info
ZFAN5_HUMAN
ATP-binding cassette transporter G2 (ABCG2) Target Info
ABCG2_HUMAN
miRNA Mature ID hsa-miR-9-5p miRNA Info
miRNA Mature AC
MIMAT0000441
Sequence ucuuugguuaucuagcuguauga
miRNA Species Homo sapiens
Regulation Mechanism The overexpression of miR-9-5p by mature miRNA mimics tranfection resulted in the decreased protein level of target FOXO1. [2]
Evidence Score (E-score) 1 +
1 Western Blot [2]
Representative Target(s) Regulated by This miRNA Beta-secretase 1 (BACE1) Target Info
BACE1_HUMAN
DNA-binding factor KBF1 (p105) Target Info
NFKB1_HUMAN
miRNA Mature ID hsa-miR-132-5p miRNA Info
miRNA Mature AC
MIMAT0004594
Sequence accguggcuuucgauuguuacu
miRNA Species Homo sapiens
Regulation Mechanism To determine whether miR-132-3p targets FOXO1a, a luciferase construct containing 2.5 kb of the 3 Untranslated Region (3 UTR) of human FOXO1a (positions 874-3385 relative to the start of the 3 UTR) was co-transfected with miR-132-3p in HEK-293T cells. [23]
Evidence Score (E-score) 1 +
1 In Situ Hybridization; Luciferase Reporter Assay; Western Blot [23]
Representative Target(s) Regulated by This miRNA Forkhead box protein O1A (FOXO1) Target Info
FOXO1_HUMAN
Nuclear factor erythroid 2-related factor 2 (Nrf2) Target Info
NF2L2_HUMAN
miRNA Mature ID hsa-miR-153-3p miRNA Info
miRNA Mature AC
MIMAT0000439
Sequence uugcauagucacaaaagugauc
miRNA Species Homo sapiens
Regulation Mechanism The overexpression of miR-153-3p by mature miRNA mimics tranfection resulted in the decreased protein level of target FOXO1. [2]
Evidence Score (E-score) 1 +
1 Western Blot [2]
Representative Target(s) Regulated by This miRNA Apoptosis regulator Bcl-2 (BCL-2) Target Info
BCL2_HUMAN
Forkhead box protein O1A (FOXO1) Target Info
FOXO1_HUMAN
miRNA Mature ID hsa-miR-339-3p miRNA Info
miRNA Mature AC
MIMAT0004702
Sequence ugagcgccucgacgacagagccg
miRNA Species Homo sapiens
Evidence Score (E-score) 1 +
1 Western Blot [24]
Representative Target(s) Regulated by This miRNA DNA-binding factor KBF1 (p105) Target Info
NFKB1_HUMAN
Forkhead box protein O1A (FOXO1) Target Info
FOXO1_HUMAN
miRNA Mature ID hsa-miR-215-3p miRNA Info
miRNA Mature AC
MIMAT0026476
Sequence ucugucauuucuuuaggccaaua
miRNA Species Homo sapiens
Regulation Mechanism miR-215 decreased FOXO1 expression by directly binding to the 3'-untranslated region (UTR) of FOXO1. [25]
Evidence Score (E-score) 1 +
1 Luciferase Reporter Assay; Western Blot [25]
Representative Target(s) Regulated by This miRNA Forkhead box protein O1A (FOXO1) Target Info
FOXO1_HUMAN
References  Top
REF 1 The FOXO1-miR27 tandem regulates myometrial invasion in endometrioid endometrial adenocarcinoma. Hum Pathol. 2014 May;45(5):942-51.
REF 2 Coordinate regulation of FOXO1 by miR-27a, miR-96, and miR-182 in breast cancer cells. J Biol Chem. 2009 Aug 28;284(35):23204-16.
REF 3 Definition of microRNAs that repress expression of the tumor suppressor gene FOXO1 in endometrial cancer. Cancer Res. 2010 Jan 1;70(1):367-77.
REF 4 Mechanism and function of decreased FOXO1 in renal cell carcinoma. J Surg Oncol. 2012 Jun 15;105(8):841-7.
REF 5 MicroRNA-96 plays an oncogenic role by targeting FOXO1 and regulating AKT/FOXO1/Bim pathway in papillary thyroid carcinoma cells. Int J Clin Exp Pathol. 2015 Sep 1;8(9):9889-900.
REF 6 MicroRNA-96 promotes the proliferation of colorectal cancer cells and targets tumor protein p53 inducible nuclear protein 1, forkhead box protein O1 (FOXO1) and FOXO3a. Mol Med Rep. 2015 Feb;11(2):1200-6.
REF 7 Human-specific microRNA regulation of FOXO1: implications for microRNA recognition element evolution. Hum Mol Genet. 2014 May 15;23(10):2593-603.
REF 8 MiR-132-3p Regulates the Osteogenic Differentiation of Thoracic Ligamentum Flavum Cells by Inhibiting Multiple Osteogenesis-Related Genes. Int J Mol Sci. 2016 Aug 20;17(8). pii: E1370.
REF 9 miR-132 upregulation promotes gastric cancer cell growth through suppression of FoxO1 translation. Tumour Biol. 2015 Aug 23. [Epub ahead of print]
REF 10 Elucidation of transcriptome-wide microRNA binding sites in human cardiac tissues by Ago2 HITS-CLIP. Nucleic Acids Res. 2016 Sep 6;44(15):7120-31.
REF 11 MiR-15a/b promote adipogenesis in porcine pre-adipocyte via repressing FoxO1. Acta Biochim Biophys Sin (Shanghai). 2014 Jul;46(7):565-71.
REF 12 Differential expression of miRNAs in colon cancer between African and Caucasian Americans: implications for cancer racial health disparities. Int J Oncol. 2014 Aug;45(2):587-94.
REF 13 Decoy oligonucleotide rescues IGF1R expression from MicroRNA-223 suppression. PLoS One. 2013 Dec 4;8(12):e82167.
REF 14 MicroRNA-223 regulates FOXO1 expression and cell proliferation. FEBS Lett. 2012 Apr 5;586(7):1038-43.
REF 15 miR-27b overexpression improves mitochondrial function in a Sirt1-dependent manner. J Physiol Biochem. 2015 Dec;71(4):753-62.
REF 16 Upregulation of miR-370 contributes to the progression of gastric carcinoma via suppression of FOXO1. Biomed Pharmacother. 2013 Jul;67(6):521-6.
REF 17 Upregulation of MircoRNA-370 induces proliferation in human prostate cancer cells by downregulating the transcription factor FOXO1. PLoS One. 2012;7(9):e45825.
REF 18 Upregulation of microRNA-107 induces proliferation in human gastric cancer cells by targeting the transcription factor FOXO1. FEBS Lett. 2014 Feb 14;588(4):538-44.
REF 19 Down-regulation of microRNA-135b inhibited growth of cervical cancer cells by targeting FOXO1. Int J Clin Exp Pathol. 2015 Sep 1;8(9):10294-304.
REF 20 Blood hsa-miR-122-5p and hsa-miR-885-5p levels associate with fatty liver and related lipoprotein metabolism-The Young Finns Study. Sci Rep. 2016 Dec 5;6:38262.
REF 21 MicroRNA-21 plays an oncogenic role by targeting FOXO1 and activating the PI3K/AKT pathway in diffuse large B-cell lymphoma. Oncotarget. 2015 Jun 20;6(17):15035-49.
REF 22 MiR-222 promotes drug-resistance of breast cancer cells to adriamycin via modulation of PTEN/Akt/FOXO1 pathway. Gene. 2017 Jan 5;596:110-118.
REF 23 Alteration of the microRNA network during the progression of Alzheimer's disease. EMBO Mol Med. 2013 Oct;5(10):1613-34.
REF 24 Acupuncture may exert its therapeutic effect through microRNA-339/Sirt2/NFB/FOXO1 axis. Biomed Res Int. 2015;2015:249013.
REF 25 miR-215 promotes cell migration and invasion of gastric cancer cell lines by targeting FOXO1. Neoplasma. 2017;64(4):579-587.

If You Find Any Error in Data or Bug in Web Service, Please Kindly Report It to Dr. Zhou and Dr. Zhang.