Target Regulator(s) Information (MicroRNA)

Content Navigation (  All   None )                                      
Target General Information
The microRNAs (miRNAs) Regulating This Target
References
Target General Information  Top
Target ID T74066 Target Info
Target Name Polycomb complex protein BMI-1 (BMI1)
Synonyms RNF51; RING finger protein 51; Polycomb group RING finger protein 4; PCGF4
Target Type Clinical trial Target
Gene Name BMI1
Biochemical Class Zinc-finger
UniProt ID
P35226
The microRNAs (miRNAs) Regulating This Target  Top
miRNA Mature ID hsa-miR-200b-3p miRNA Info
miRNA Mature AC
MIMAT0000318
Sequence uaauacugccugguaaugauga
miRNA Species Homo sapiens
Regulation Mechanism The overexpression of miR-200b-3p by mature miRNA mimics tranfection resulted in the decreased protein level of target BMI1. [2]
Evidence Score (E-score) 5 +
1 Immunoblot; Luciferase Reporter Assay; qRT-PCR [1]
2 Immunoblot; Luciferase Reporter Assay; qRT-PCR [2]
3 Immunohistochemistry; qRT-PCR; Western Blot [3]
4 Luciferase Reporter Assay [4]
5 Luciferase Reporter Assay; Microarray; qRT-PCR; Western Blot [5]
Representative Target(s) Regulated by This miRNA Apoptosis regulator Bcl-2 (BCL-2) Target Info
BCL2_HUMAN
CDK inhibitor 1B p27Kip1 (CDKN1B) Target Info
CDN1B_HUMAN
miRNA Mature ID hsa-miR-203a-3p miRNA Info
miRNA Mature AC
MIMAT0000264
Sequence gugaaauguuuaggaccacuag
miRNA Species Homo sapiens
Regulation Mechanism EZH2-regulated microRNA miR-203a inhibit expression of PRC1 proteins BMI1. [5]
Evidence Score (E-score) 5 +
1 Immunoblot; In Situ Hybridization; Luciferase Reporter Assay; qRT-PCR; Western Blot [6]
2 Luciferase Reporter Assay [7]
3 Luciferase Reporter Assay; qRT-PCR; Immunocytochemistry; Western Blot [8]
4 Luciferase Reporter Assay; qRT-PCR; Western Blot [9]
5 Luciferase Reporter Assay; Western Blot [5]
Representative Target(s) Regulated by This miRNA Apoptosis inhibitor survivin (BIRC5) Target Info
BIRC5_HUMAN
Apoptosis regulator Bcl-W (BCL-W) Target Info
B2CL2_HUMAN
miRNA Mature ID hsa-miR-15a-5p miRNA Info
miRNA Mature AC
MIMAT0000068
Sequence uagcagcacauaaugguuugug
miRNA Species Homo sapiens
Regulation Mechanism The overexpression of miR-15a-5p by mature miRNA precursor transfection resulted in the decreased protein level of target BMI1. [2]
Evidence Score (E-score) 4 +
1 Immunohistochemistry; Luciferase Reporter Assay; qRT-PCR; Western Blot [10]
2 Immunohistochemistry; Luciferase Reporter Assay; qRT-PCR; Western Blot [2]
3 Immunohistochemistry; Microarray; qRT-PCR; Western Blot [11]
4 Luciferase Reporter Assay; Western Blot [12]
Representative Target(s) Regulated by This miRNA Amyloid beta A4 protein (APP) Target Info
A4_HUMAN
Apoptosis regulator Bcl-2 (BCL-2) Target Info
BCL2_HUMAN
miRNA Mature ID hsa-miR-200c-3p miRNA Info
miRNA Mature AC
MIMAT0000617
Sequence uaauacugccggguaaugaugga
miRNA Species Homo sapiens
Regulation Mechanism BMI1 protein expression was decreased in cells transfected by miR-200c. [14]
Evidence Score (E-score) 3 +
1 Immunoblot; Luciferase Reporter Assay; qRT-PCR; Northern Blot; Western Blot [13]
2 Luciferase Reporter Assay; Microarray; qRT-PCR; Western Blot [5]
3 Luciferase Reporter Assay; Western Blot [14]
Representative Target(s) Regulated by This miRNA Activin receptor type IIB (ACVR2B) Target Info
AVR2B_HUMAN
Apoptosis regulator Bcl-2 (BCL-2) Target Info
BCL2_HUMAN
miRNA Mature ID hsa-miR-495-3p miRNA Info
miRNA Mature AC
MIMAT0002817
Sequence aaacaaacauggugcacuucuu
miRNA Species Homo sapiens
Regulation Mechanism Mimics of miR-495 repressed expression of the luc/3'UTR BMI1. [16]
Evidence Score (E-score) 3 +
1 Luciferase Reporter Assay; qRT-PCR; Western Blot [15]
2 Luciferase Reporter Assay; Western Blot [16]
3 Luciferase Reporter Assay; Western Blot; Immunohistochemistry [17]
Representative Target(s) Regulated by This miRNA Endoplasmic reticulum chaperone BiP (HSPA5) Target Info
BIP_HUMAN
Forkhead box protein C1 (FOXC1) Target Info
FOXC1_HUMAN
miRNA Mature ID hsa-miR-200c-5p miRNA Info
miRNA Mature AC
MIMAT0004657
Sequence cgucuuacccagcaguguuugg
miRNA Species Homo sapiens
Regulation Mechanism BMI-1 is a direct target of miR-200c. [19]
Evidence Score (E-score) 2 +
1 Luciferase Reporter Assay; qRT-PCR; Western Blot [18]
2 Luciferase Reporter Assay; Western Blot [19]
Representative Target(s) Regulated by This miRNA Cytochrome P450 1B1 (CYP1B1) Target Info
CP1B1_HUMAN
Epithelial cadherin (CDH1) Target Info
CADH1_HUMAN
miRNA Mature ID hsa-miR-302b-3p miRNA Info
miRNA Mature AC
MIMAT0000715
Sequence uaagugcuuccauguuuuaguag
miRNA Species Homo sapiens
Regulation Mechanism The overexpression of miR-302b-3p by mature miRNA mimics tranfection resulted in the decreased protein level of target BMI1. [2]
Evidence Score (E-score) 2 +
1 Luciferase Reporter Assay; Microarray; Northern Blot; Western Blot [20]
2 Luciferase Reporter Assay; Microarray; Northern Blot; Western Blot [2]
Representative Target(s) Regulated by This miRNA Cyclin-dependent kinase 2 (CDK2) Target Info
CDK2_HUMAN
Dihydrothymine dehydrogenase (DPYD) Target Info
DPYD_HUMAN
miRNA Mature ID hsa-miR-338-5p miRNA Info
miRNA Mature AC
MIMAT0004701
Sequence aacaauauccuggugcugagug
miRNA Species Homo sapiens
Evidence Score (E-score) 2 +
1 ChIP; Immunohistochemistry; Luciferase Reporter Assay; qRT-PCR; Western Blot [21]
2 HITS-CLIP [22]
Representative Target(s) Regulated by This miRNA LDL receptor related protein-1 (LRP-1) Target Info
LRP1_HUMAN
Lysophosphatidic acid receptor 1 (LPAR1) Target Info
LPAR1_HUMAN
miRNA Mature ID hsa-miR-494-3p miRNA Info
miRNA Mature AC
MIMAT0002816
Sequence ugaaacauacacgggaaaccuc
miRNA Species Homo sapiens
Regulation Mechanism Mimics of miR-494 repressed expression of the luc/3'UTR BMI1. [16]
Evidence Score (E-score) 2 +
1 Luciferase Reporter Assay; qRT-PCR; Western Blot [23]
2 Luciferase Reporter Assay; Western Blot [16]
Representative Target(s) Regulated by This miRNA Apoptosis inhibitor survivin (BIRC5) Target Info
BIRC5_HUMAN
Apoptosis regulator Bcl-2 (BCL-2) Target Info
BCL2_HUMAN
miRNA Mature ID hsa-miR-708-5p miRNA Info
miRNA Mature AC
MIMAT0004926
Sequence aaggagcuuacaaucuagcuggg
miRNA Species Homo sapiens
Evidence Score (E-score) 2 +
1 Luciferase Reporter Assay; Microarray; qRT-PCR; Western Blot [24]
2 Luciferase Reporter Assay; Microarray; qRT-PCR; Western Blot [2]
Representative Target(s) Regulated by This miRNA Apoptosis inhibitor survivin (BIRC5) Target Info
BIRC5_HUMAN
Apoptosis regulator Bcl-2 (BCL-2) Target Info
BCL2_HUMAN
miRNA Mature ID hsa-let-7g-5p miRNA Info
miRNA Mature AC
MIMAT0000414
Sequence ugagguaguaguuuguacaguu
miRNA Species Homo sapiens
Evidence Score (E-score) 1 +
1 Western Blot; qRT-PCR [25]
Representative Target(s) Regulated by This miRNA Apoptosis regulator Bcl-xL (BCL-xL) Target Info
B2CL1_HUMAN
Caspase-3 (CASP3) Target Info
CASP3_HUMAN
miRNA Mature ID hsa-miR-15b-5p miRNA Info
miRNA Mature AC
MIMAT0000417
Sequence uagcagcacaucaugguuuaca
miRNA Species Homo sapiens
Regulation Mechanism The overexpression of miR-15b-5p by mature miRNA mimics tranfection resulted in the decreased protein level of target BMI1. [2]
Evidence Score (E-score) 1 +
1 Western Blot; Luciferase Reporter Assay [2]
Representative Target(s) Regulated by This miRNA Apoptosis regulator Bcl-2 (BCL-2) Target Info
BCL2_HUMAN
Checkpoint kinase-1 (CHK1) Target Info
CHK1_HUMAN
miRNA Mature ID hsa-miR-16-5p miRNA Info
miRNA Mature AC
MIMAT0000069
Sequence uagcagcacguaaauauuggcg
miRNA Species Homo sapiens
Regulation Mechanism The overexpression of miR-16-5p by mature miRNA precursor transfection resulted in the decreased protein level of target BMI1. [2]
Evidence Score (E-score) 1 +
1 Western Blot; Luciferase Reporter Assay [2]
Representative Target(s) Regulated by This miRNA Apoptosis regulator Bcl-2 (BCL-2) Target Info
BCL2_HUMAN
Corticotropin-releasing factor binding protein (CRHBP) Target Info
CRHBP_HUMAN
miRNA Mature ID hsa-miR-183-5p miRNA Info
miRNA Mature AC
MIMAT0000261
Sequence uauggcacugguagaauucacu
miRNA Species Homo sapiens
Regulation Mechanism miR-183 is downregulated in gastric cancer cells and tissues and inhibits gastric cancer cell proliferation and invasion by targeting Bmi-1. [26]
Evidence Score (E-score) 1 +
1 Luciferase Reporter Assay; Western Blot [26]
Representative Target(s) Regulated by This miRNA Dickkopf-related protein 3 (DKK3) Target Info
DKK3_HUMAN
Early growth response protein 1 (EGR-1) Target Info
EGR1_HUMAN
miRNA Mature ID hsa-miR-192-5p miRNA Info
miRNA Mature AC
MIMAT0000222
Sequence cugaccuaugaauugacagcc
miRNA Species Homo sapiens
Regulation Mechanism miR-192 suppressed expression of BMI1. [11]
Evidence Score (E-score) 1 +
1 Immunohistochemistry; Western Blot [11]
Representative Target(s) Regulated by This miRNA Activated leukocyte cell adhesionmolecule (ALCAM) Target Info
CD166_HUMAN
Activin receptor type IIB (ACVR2B) Target Info
AVR2B_HUMAN
miRNA Mature ID hsa-miR-21-5p miRNA Info
miRNA Mature AC
MIMAT0000076
Sequence uagcuuaucagacugauguuga
miRNA Species Homo sapiens
Regulation Mechanism BMI-1 positively regulates stem cell-like properties via upregulating miR-21. [27]
Evidence Score (E-score) 1 +
1 Luciferase Reporter Assay; Western Blot [27]
Representative Target(s) Regulated by This miRNA Apoptosis antigen ligand (CD178) Target Info
TNFL6_HUMAN
Apoptosis regulator Bcl-2 (BCL-2) Target Info
BCL2_HUMAN
miRNA Mature ID hsa-miR-300 miRNA Info
miRNA Mature AC
MIMAT0004903
Sequence uauacaagggcagacucucucu
miRNA Species Homo sapiens
Evidence Score (E-score) 1 +
1 Luciferase Reporter Assay; Western Blot [16]
Representative Target(s) Regulated by This miRNA Bromodomain-containing protein 7 (BRD7) Target Info
BRD7_HUMAN
Cellular tumor antigen p53 (TP53) Target Info
P53_HUMAN
miRNA Mature ID hsa-miR-302a-3p miRNA Info
miRNA Mature AC
MIMAT0000684
Sequence uaagugcuuccauguuuugguga
miRNA Species Homo sapiens
Regulation Mechanism BMI-1, target of miR-302a, were suppressed by treatment with SAHA and DzNep, leading to apoptosis, cell cycle arrest and reduced migration of AGS and HepG2 cells. [28]
Evidence Score (E-score) 1 +
1 Western Blot [28]
Representative Target(s) Regulated by This miRNA ATP-binding cassette transporter A1 (ABCA1) Target Info
ABCA1_HUMAN
Cyclin-dependent kinase 1 (CDK1) Target Info
CDK1_HUMAN
miRNA Mature ID hsa-miR-30e-5p miRNA Info
miRNA Mature AC
MIMAT0000692
Sequence uguaaacauccuugacuggaag
miRNA Species Homo sapiens
Regulation Mechanism TAMs causes increased Bmi1 expression through miR-30e suppression. [29]
Evidence Score (E-score) 1 +
1 Immunohistochemistry; Luciferase Reporter Assay; Western Blot [29]
Representative Target(s) Regulated by This miRNA Caspase-3 (CASP3) Target Info
CASP3_HUMAN
Cellular tumor antigen p53 (TP53) Target Info
P53_HUMAN
miRNA Mature ID hsa-miR-376c-3p miRNA Info
miRNA Mature AC
MIMAT0000720
Sequence aacauagaggaaauuccacgu
miRNA Species Homo sapiens
Regulation Mechanism The level of BMI1 protein was markedly decreased by miR-376c overexpression but increased by silencing of miR-376c. [30]
Evidence Score (E-score) 1 +
1 Luciferase Reporter Assay; Western Blot [30]
Representative Target(s) Regulated by This miRNA Apoptosis regulator Bcl-2 (BCL-2) Target Info
BCL2_HUMAN
Insulin-like growth factor I receptor (IGF1R) Target Info
IGF1R_HUMAN
miRNA Mature ID hsa-miR-452-5p miRNA Info
miRNA Mature AC
MIMAT0001635
Sequence aacuguuugcagaggaaacuga
miRNA Species Homo sapiens
Regulation Mechanism miR-452 directly targeted and suppressed multiple stemness regulators BMI-1. [31]
Evidence Score (E-score) 1 +
1 Western Blot [31]
Representative Target(s) Regulated by This miRNA CDK inhibitor 1B p27Kip1 (CDKN1B) Target Info
CDN1B_HUMAN
Dihydropyrimidinase related protein 2 (DPYSL2) Target Info
DPYL2_HUMAN
miRNA Mature ID hsa-miR-487b-3p miRNA Info
miRNA Mature AC
MIMAT0003180
Sequence aaucguacagggucauccacuu
miRNA Species Homo sapiens
Regulation Mechanism miR-487b directly targeted BMI1. [32]
Evidence Score (E-score) 1 +
1 Luciferase Reporter Assay; Western Blot [32]
Representative Target(s) Regulated by This miRNA Metabotropic glutamate receptor 3 (mGluR3) Target Info
GRM3_HUMAN
Polycomb complex protein BMI-1 (BMI1) Target Info
BMI1_HUMAN
miRNA Mature ID hsa-miR-128-3p miRNA Info
miRNA Mature AC
MIMAT0000424
Sequence ucacagugaaccggucucuuu
miRNA Species Homo sapiens
Evidence Score (E-score) 1 +
1 Luciferase Reporter Assay [2]
Representative Target(s) Regulated by This miRNA Adenosine A2b receptor (ADORA2B) Target Info
AA2BR_HUMAN
NT-3 growth factor receptor (TrkC) Target Info
NTRK3_HUMAN
miRNA Mature ID hsa-miR-15a-3p miRNA Info
miRNA Mature AC
MIMAT0004488
Sequence caggccauauugugcugccuca
miRNA Species Homo sapiens
Regulation Mechanism miR-15a binds on the 3'UTR of BMI1. [33]
Evidence Score (E-score) 1 +
1 Luciferase Reporter Assay; Western Blot [33]
Representative Target(s) Regulated by This miRNA Apoptosis regulator Bcl-2 (BCL-2) Target Info
BCL2_HUMAN
Mixed lineage kinase 1 (MAP3K9) Target Info
M3K9_HUMAN
miRNA Mature ID hsa-miR-3622b-5p miRNA Info
miRNA Mature AC
MIMAT0018005
Sequence aggcaugggaggucagguga
miRNA Species Homo sapiens
Regulation Mechanism miR-3622b represses polycomb repressor BMI1. [34]
Evidence Score (E-score) 1 +
1 Luciferase Reporter Assay [34]
Representative Target(s) Regulated by This miRNA Epidermal growth factor receptor (EGFR) Target Info
EGFR_HUMAN
Erbb2 tyrosine kinase receptor (HER2) Target Info
ERBB2_HUMAN
miRNA Mature ID hsa-miR-544a miRNA Info
miRNA Mature AC
MIMAT0003164
Sequence auucugcauuuuuagcaaguuc
miRNA Species Homo sapiens
Regulation Mechanism Mimics of miR-544 repressed expression of the luc/3'UTR BMI1. [16]
Evidence Score (E-score) 1 +
1 Luciferase Reporter Assay; Western Blot [16]
Representative Target(s) Regulated by This miRNA Epithelial cadherin (CDH1) Target Info
CADH1_HUMAN
Polycomb complex protein BMI-1 (BMI1) Target Info
BMI1_HUMAN
miRNA Mature ID hsa-miR-128-1-5p miRNA Info
miRNA Mature AC
MIMAT0026477
Sequence cggggccguagcacugucugaga
miRNA Species Homo sapiens
Regulation Mechanism miR-128-1 directly targets BMI1. [35]
Evidence Score (E-score) 1 +
1 Luciferase Reporter Assay; Western Blot [35]
Representative Target(s) Regulated by This miRNA Polycomb complex protein BMI-1 (BMI1) Target Info
BMI1_HUMAN
References  Top
REF 1 The miR-200b-ZEB1 circuit regulates diverse stemness of human hepatocellular carcinoma. Mol Carcinog. 2017 Sep;56(9):2035-2047.
REF 2 Targeting of the Bmi-1 oncogene/stem cell renewal factor by microRNA-128 inhibits glioma proliferation and self-renewal. Cancer Res. 2008 Nov 15;68(22):9125-30.
REF 3 miR-200b suppresses cell proliferation, migration and enhances chemosensitivity in prostate cancer by regulating Bmi-1. Oncol Rep. 2014 Feb;31(2):910-8.
REF 4 Methylation-associated silencing of miR-200b facilitates human hepatocellular carcinoma progression by directly targeting BMI1. Oncotarget. 2016 Apr 5;7(14):18684-93.
REF 5 Coordinated regulation of polycomb group complexes through microRNAs in cancer. Cancer Cell. 2011 Aug 16;20(2):187-99.
REF 6 Regulatory Role of mir-203 in Prostate Cancer Progression and Metastasis. Clin Cancer Res. 2011 Aug 15;17(16):5287-98.
REF 7 miR-203 inhibits proliferation and self-renewal of leukemia stem cells by targeting survivin and Bmi-1. Sci Rep. 2016 Feb 5;6:19995.
REF 8 MiR-203 inhibits melanoma invasive and proliferative abilities by targeting the polycomb group gene BMI1. Biochem Biophys Res Commun. 2015 Jan 2;456(1):361-6.
REF 9 miR-203 inhibits the proliferation and self-renewal of esophageal cancer stem-like cells by suppressing stem renewal factor Bmi-1. Stem Cells Dev. 2014 Mar 15;23(6):576-85.
REF 10 Reduction of gastric cancer proliferation and invasion by miR-15a mediated suppression of Bmi-1 translation. Oncotarget. 2016 Mar 22;7(12):14522-36.
REF 11 Negative regulation of Bmi-1 by AMPK and implication in cancer progression. Oncotarget. 2016 Feb 2;7(5):6188-200.
REF 12 MiR-15a and MiR-16 control Bmi-1 expression in ovarian cancer. Cancer Res. 2009 Dec 1;69(23):9090-5.
REF 13 MicroRNA-200c attenuates tumour growth and metastasis of presumptive head and neck squamous cell carcinoma stem cells. J Pathol. 2011 Mar;223(4):482-95.
REF 14 Downregulation of miRNA-200c links breast cancer stem cells with normal stem cells. Cell. 2009 Aug 7;138(3):592-603.
REF 15 MiR-495 Promotes Senescence of Mesenchymal Stem Cells by Targeting Bmi-1. Cell Physiol Biochem. 2017;42(2):780-796.
REF 16 MicroRNAs in the imprinted DLK1-DIO3 region repress the epithelial-to-mesenchymal transition by targeting the TWIST1 protein signaling network. J Biol Chem. 2012 Dec 14;287(51):42695-707.
REF 17 Downregulated miR-495 [Corrected] Inhibits the G1-S Phase Transition by Targeting Bmi-1 in Breast Cancer. Medicine (Baltimore). 2015 May;94(21):e718.
REF 18 MicroRNA-200c suppresses cell growth and metastasis by targeting Bmi-1 and E2F3 in renal cancer cells. Exp Ther Med. 2017 Apr;13(4):1329-1336.
REF 19 miR-200c inhibits invasion, migration and proliferation of bladder cancer cells through down-regulation of BMI-1 and E2F3. J Transl Med. 2014 Nov 4;12:305.
REF 20 MicroRNA miR-302 inhibits the tumorigenecity of human pluripotent stem cells by coordinate suppression of the CDK2 and CDK4/6 cell cycle pathways. Cancer Res. 2010 Nov 15;70(22):9473-82.
REF 21 MECP2 promotes the growth of gastric cancer cells by suppressing miR-338-mediated antiproliferative effect. Oncotarget. 2016 Jun 7;7(23):34845-59.
REF 22 Argonaute HITS-CLIP decodes microRNA-mRNA interaction maps. Nature. 2009 Jul 23;460(7254):479-86.
REF 23 miR-494-3p Induces Cellular Senescence and Enhances Radiosensitivity in Human Oral Squamous Carcinoma Cells. Int J Mol Sci. 2016 Jul 8;17(7). pii: E1092.
REF 24 MicroRNA-708 induces apoptosis and suppresses tumorigenicity in renal cancer cells. Cancer Res. 2011 Oct 1;71(19):6208-19.
REF 25 Hsa-let-7g inhibits proliferation of hepatocellular carcinoma cells by downregulation of c-Myc and upregulation of p16(INK4A). Int J Cancer. 2011 Jan 15;128(2):319-31.
REF 26 MicroRNA-183 inhibits gastric cancer proliferation and invasion via directly targeting Bmi-1. Oncol Lett. 2014 Nov;8(5):2345-2351.
REF 27 Bmi-1 regulates stem cell-like properties of gastric cancer cells via modulating miRNAs. J Hematol Oncol. 2016 Sep 20;9(1):90.
REF 28 Inhibitors of enhancer of zeste homolog 2 (EZH2) activate tumor-suppressor microRNAs in human cancer cells. Oncogenesis. 2014 May 26;3:e104.
REF 29 Identification of miR-30e* regulation of Bmi1 expression mediated by tumor-associated macrophages in gastrointestinal cancer. PLoS One. 2013 Nov 28;8(11):e81839.
REF 30 miR-376c inhibits cervical cancer cell proliferation and invasion by targeting BMI1. Int J Exp Pathol. 2016 Jun;97(3):257-65.
REF 31 Downregulation of miR-452 promotes stem-like traits and tumorigenicity of gliomas. Clin Cancer Res. 2013 Jul 1;19(13):3429-38.
REF 32 Cigarette smoke mediates epigenetic repression of miR-487b during pulmonary carcinogenesis. J Clin Invest. 2013 Mar;123(3):1241-61.
REF 33 miR-15a/miR-16 induces mitochondrial dependent apoptosis in breast cancer cells by suppressing oncogene BMI1. Life Sci. 2016 Nov 1;164:60-70.
REF 34 Novel tumor suppressor microRNA at frequently deleted chromosomal region 8p21 regulates epidermal growth factor receptor in prostate cancer. Oncotarget. 2016 Oct 25;7(43):70388-70403.
REF 35 miR128-1 inhibits the growth of glioblastoma multiforme and glioma stem-like cells via targeting BMI1 and E2F3. Oncotarget. 2016 Nov 29;7(48):78813-78826.

If You Find Any Error in Data or Bug in Web Service, Please Kindly Report It to Dr. Zhou and Dr. Zhang.