Target Regulator(s) Information (MicroRNA)

Content Navigation (  All   None )                                      
Target General Information
The microRNAs (miRNAs) Regulating This Target
References
Target General Information  Top
Target ID T48069 Target Info
Target Name Insulin-like growth factor I receptor (IGF1R)
Synonyms Type 1 insulin-like growth factor receptor; Insulin-like growth factor 1 receptor; IGF-IR; IGF-I receptor; IGF-1R; IGF-1 receptor; CD221 antigen; CD221
Target Type Successful Target
Gene Name IGF1R
Biochemical Class Kinase
UniProt ID
P08069
The microRNAs (miRNAs) Regulating This Target  Top
miRNA Mature ID hsa-miR-99a-5p miRNA Info
miRNA Mature AC
MIMAT0000097
Sequence aacccguagauccgaucuugug
miRNA Species Homo sapiens
Regulation Mechanism hsa-miR-99a regulates the expression of IGF1R through interaction with its 3'UTR. [7]
Evidence Score (E-score) 7 +
1 Immunoblot; Luciferase Reporter Assay; qRT-PCR [1]
2 Luciferase Reporter Assay; qRT-PCR [2]
3 Luciferase Reporter Assay; qRT-PCR; Western Blot [3]
4 Luciferase Reporter Assay; qRT-PCR; Western Blot [4]
5 Luciferase Reporter Assay; qRT-PCR; Western Blot [5]
6 Luciferase Reporter Assay; qRT-PCR; Western Blot [6]
7 Luciferase Reporter Assay; Western Blot [7]
Representative Target(s) Regulated by This miRNA Endothelial plasminogen activator inhibitor (SERPINE1) Target Info
PAI1_HUMAN
Fibroblast growth factor receptor 3 (FGFR3) Target Info
FGFR3_HUMAN
miRNA Mature ID hsa-miR-100-5p miRNA Info
miRNA Mature AC
MIMAT0000098
Sequence aacccguagauccgaacuugug
miRNA Species Homo sapiens
Regulation Mechanism miR-100 down-regulation may involve direct transcriptional repression by IGF1R. [7]
Evidence Score (E-score) 4 +
1 ELISA; GFP Reporter Assay; Luciferase Reporter Assay; qRT-PCR; Western Blot [8]
2 Luciferase Reporter Assay [7]
3 Luciferase Reporter Assay [9]
4 Luciferase Reporter Assay; qRT-PCR; Western Blot [10]
Representative Target(s) Regulated by This miRNA ATM serine/threonine kinase (ATM) Target Info
ATM_HUMAN
Bone morphogenetic protein receptor (BMPR2) Target Info
BMPR2_HUMAN
miRNA Mature ID hsa-miR-145-5p miRNA Info
miRNA Mature AC
MIMAT0000437
Sequence guccaguuuucccaggaaucccu
miRNA Species Homo sapiens
Regulation Mechanism The d1245 mutant of the IGF-IR is truncated at amino acid 1245 of the coding sequence (nucleotides 3,783-3,785) and has no 3' UTR. Expression of d1245 IGF-IR mutant does not rescue HCT116/Dicerex5 cells from growth inhibition by miR145.//The failure of miR145 to decrease IGF-IR mRNA levels suggests that the 3' UTR of the IGF-IR may be the target of miR145. [14]
Evidence Score (E-score) 4 +
1 Luciferase Reporter Assay; qRT-PCR [11]
2 Luciferase Reporter Assay; Western Blot [12]
3 qRT-PCR; Luciferase Reporter Assay; Western Blot [13]
4 qRT-PCR; Western Blot [14]
Representative Target(s) Regulated by This miRNA A proliferation-inducing ligand (APRIL) Target Info
TNF13_HUMAN
Alkaline phosphatase (ALPPL2) Target Info
PPBN_HUMAN
miRNA Mature ID hsa-miR-223-3p miRNA Info
miRNA Mature AC
MIMAT0000280
Sequence ugucaguuugucaaauacccca
miRNA Species Homo sapiens
Regulation Mechanism IGF1R was the functional target for miR-223 suppression of cell proliferation and its downstream PI3K/Akt/mTOR/p70S6K pathway suppressed by miR-223 was by targeting IGF-1R. [16]
Evidence Score (E-score) 4 +
1 Luciferase Reporter Assay [15]
2 Luciferase Reporter Assay; Western Blot [16]
3 Microarray; qRT-PCR; Western Blot [17]
4 qRT-PCR; Western Blot [18]
Representative Target(s) Regulated by This miRNA ATM serine/threonine kinase (ATM) Target Info
ATM_HUMAN
C-X-C motif chemokine 2 (CXCL2) Target Info
CXCL2_HUMAN
miRNA Mature ID hsa-miR-139-5p miRNA Info
miRNA Mature AC
MIMAT0000250
Sequence ucuacagugcacgugucuccagu
miRNA Species Homo sapiens
Regulation Mechanism IGF-IR is a direct functional target of miR-139 in CRC cell metastasis. [19]
Evidence Score (E-score) 3 +
1 Luciferase Reporter Assay [19]
2 Luciferase Reporter Assay; Western Blot [20]
3 Luciferase Reporter Assay; Western Blot; qRT-PCR [21]
Representative Target(s) Regulated by This miRNA Apoptosis regulator Bcl-2 (BCL-2) Target Info
BCL2_HUMAN
C-X-C chemokine receptor type 4 (CXCR4) Target Info
CXCR4_HUMAN
miRNA Mature ID hsa-miR-122-5p miRNA Info
miRNA Mature AC
MIMAT0000421
Sequence uggagugugacaaugguguuug
miRNA Species Homo sapiens
Regulation Mechanism IGF1R protein level was negatively regulated by miR-122 in HepG2 and Huh-7 cells. [23]
Evidence Score (E-score) 3 +
1 Luciferase Reporter Assay; qRT-PCR; Western Blot [22]
2 Luciferase Reporter Assay; Western Blot [23]
3 Reporter Assay; qRT-PCR [24]
Representative Target(s) Regulated by This miRNA Apoptosis regulator Bcl-W (BCL-W) Target Info
B2CL2_HUMAN
Apoptosis regulator Bcl-xL (BCL-xL) Target Info
B2CL1_HUMAN
miRNA Mature ID hsa-miR-497-5p miRNA Info
miRNA Mature AC
MIMAT0002820
Sequence cagcagcacacugugguuugu
miRNA Species Homo sapiens
Regulation Mechanism Only overexpression of miR-497 led to suppression of the IGF1-R 3'UTR activity and downregulation of the endogenous IGF1-R protein in CRC cells. [27]
Evidence Score (E-score) 3 +
1 In Situ Hybridization; Luciferase Reporter Assay; qRT-PCR; Western Blot [25]
2 Luciferase Reporter Assay [26]
3 Luciferase Reporter Assay [27]
Representative Target(s) Regulated by This miRNA Angiomotin (AMOT) Target Info
AMOT_HUMAN
Apoptosis inhibitor survivin (BIRC5) Target Info
BIRC5_HUMAN
miRNA Mature ID hsa-miR-503-5p miRNA Info
miRNA Mature AC
MIMAT0002874
Sequence uagcagcgggaacaguucugcag
miRNA Species Homo sapiens
Regulation Mechanism Overexpression of miR-503 resulted in the decreased protein level of IGF-1R suggesting miR-503 was involved in the regulation of IGF-1R expression. [30]
Evidence Score (E-score) 3 +
1 Immunohistochemistry; Luciferase Reporter Assay; qRT-PCR; Western Blot [28]
2 Luciferase Reporter Assay; qRT-PCR; Western Blot [29]
3 Luciferase Reporter Assay; Western Blot [30]
Representative Target(s) Regulated by This miRNA Apoptosis regulator Bcl-2 (BCL-2) Target Info
BCL2_HUMAN
CD40L receptor (CD40) Target Info
TNR5_HUMAN
miRNA Mature ID hsa-let-7b-5p miRNA Info
miRNA Mature AC
MIMAT0000063
Sequence ugagguaguagguugugugguu
miRNA Species Homo sapiens
Evidence Score (E-score) 2 +
1 Immunohistochemistry; Luciferase Reporter Assay; qRT-PCR; Western Blot [31]
2 PAR-CLIP [32]
Representative Target(s) Regulated by This miRNA Activin receptor-like kinase 2 (ALK-2) Target Info
ACVR1_HUMAN
CDK inhibitor 1B p27Kip1 (CDKN1B) Target Info
CDN1B_HUMAN
miRNA Mature ID hsa-let-7c-5p miRNA Info
miRNA Mature AC
MIMAT0000064
Sequence ugagguaguagguuguaugguu
miRNA Species Homo sapiens
Evidence Score (E-score) 2 +
1 Luciferase Reporter Assay; qRT-PCR; Western Blot [4]
2 PAR-CLIP [32]
Representative Target(s) Regulated by This miRNA Apoptosis regulator Bcl-xL (BCL-xL) Target Info
B2CL1_HUMAN
Caspase-3 (CASP3) Target Info
CASP3_HUMAN
miRNA Mature ID hsa-let-7e-5p miRNA Info
miRNA Mature AC
MIMAT0000066
Sequence ugagguaggagguuguauaguu
miRNA Species Homo sapiens
Evidence Score (E-score) 2 +
1 Luciferase Reporter Assay; qRT-PCR; Western Blot [33]
2 PAR-CLIP [32]
Representative Target(s) Regulated by This miRNA Apoptosis antigen ligand (CD178) Target Info
TNFL6_HUMAN
Aurora kinase B (AURKB) Target Info
AURKB_HUMAN
miRNA Mature ID hsa-miR-133b miRNA Info
miRNA Mature AC
MIMAT0000770
Sequence uuugguccccuucaaccagcua
miRNA Species Homo sapiens
Regulation Mechanism Overexpression of miR-133b decreased the expression of IGF1R. [34]
Evidence Score (E-score) 2 +
1 Luciferase Reporter Assay [34]
2 Western Blot [35]
Representative Target(s) Regulated by This miRNA Apoptosis mediating surface antigen FAS (FAS) Target Info
TNR6_HUMAN
Apoptosis regulator Bcl-W (BCL-W) Target Info
B2CL2_HUMAN
miRNA Mature ID hsa-miR-335-5p miRNA Info
miRNA Mature AC
MIMAT0000765
Sequence ucaagagcaauaacgaaaaaugu
miRNA Species Homo sapiens
Evidence Score (E-score) 2 +
1 PAR-CLIP [36]
2 Reporter Assay; Western Blot [37]
Representative Target(s) Regulated by This miRNA Apoptosis inhibitor survivin (BIRC5) Target Info
BIRC5_HUMAN
Apoptosis regulator Bcl-W (BCL-W) Target Info
B2CL2_HUMAN
miRNA Mature ID hsa-miR-378a-3p miRNA Info
miRNA Mature AC
MIMAT0000732
Sequence acuggacuuggagucagaaggc
miRNA Species Homo sapiens
Evidence Score (E-score) 2 +
1 Luciferase Reporter Assay [38]
2 Luciferase Reporter Assay [14]
Representative Target(s) Regulated by This miRNA Aromatase (CYP19A1) Target Info
CP19A_HUMAN
Cyclin-dependent kinase 6 (CDK6) Target Info
CDK6_HUMAN
miRNA Mature ID hsa-miR-494-3p miRNA Info
miRNA Mature AC
MIMAT0002816
Sequence ugaaacauacacgggaaaccuc
miRNA Species Homo sapiens
Regulation Mechanism miR-494 functions as a tumor suppressor in EOC by targeting IGF1R. [40]
Evidence Score (E-score) 2 +
1 Luciferase Reporter Assay; qRT-PCR; Western Blot [39]
2 Luciferase Reporter Assay; Western Blot [40]
Representative Target(s) Regulated by This miRNA Apoptosis inhibitor survivin (BIRC5) Target Info
BIRC5_HUMAN
Apoptosis regulator Bcl-2 (BCL-2) Target Info
BCL2_HUMAN
miRNA Mature ID hsa-miR-630 miRNA Info
miRNA Mature AC
MIMAT0003299
Sequence aguauucuguaccagggaaggu
miRNA Species Homo sapiens
Evidence Score (E-score) 2 +
1 ELISA; Immunoblot; qRT-PCR [41]
2 Luciferase Reporter Assay; Northern Blot; Western Blot [42]
Representative Target(s) Regulated by This miRNA Apoptosis regulator Bcl-2 (BCL-2) Target Info
BCL2_HUMAN
Apoptosis regulator Bcl-W (BCL-W) Target Info
B2CL2_HUMAN
miRNA Mature ID hsa-miR-4458 miRNA Info
miRNA Mature AC
MIMAT0018980
Sequence agagguagguguggaagaa
miRNA Species Homo sapiens
Evidence Score (E-score) 2 +
1 Luciferase Reporter Assay; qRT-PCR; Western Blot [43]
2 PAR-CLIP [32]
Representative Target(s) Regulated by This miRNA Insulin-like growth factor I receptor (IGF1R) Target Info
IGF1R_HUMAN
miRNA Mature ID hsa-miR-140-5p miRNA Info
miRNA Mature AC
MIMAT0000431
Sequence cagugguuuuacccuaugguag
miRNA Species Homo sapiens
Regulation Mechanism IGF1R as a target gene of miR-140 and knockdown of IGF1R inhibited cell proliferation and invasion resembling that of miR-140 overexpression, while overexpression of IGF1R attenuated the function of miR-140 in NSCLC cells. [44]
Evidence Score (E-score) 1 +
1 Luciferase Reporter Assay; Western Blot [44]
Representative Target(s) Regulated by This miRNA Adenosine deaminase (ADA) Target Info
ADA_HUMAN
Aspartyl aminopeptidase (DNPEP) Target Info
DNPEP_HUMAN
miRNA Mature ID hsa-miR-141-3p miRNA Info
miRNA Mature AC
MIMAT0000432
Sequence uaacacugucugguaaagaugg
miRNA Species Homo sapiens
Regulation Mechanism Protein levels of IGF1R were inhibited by miR-141, while overexpression of IGF1R reversed the effects of miR-141. [45]
Evidence Score (E-score) 1 +
1 qRT-PCR; Western Blot [45]
Representative Target(s) Regulated by This miRNA Activin receptor type IIB (ACVR2B) Target Info
AVR2B_HUMAN
Bromodomain-containing protein 3 (BRD3) Target Info
BRD3_HUMAN
miRNA Mature ID hsa-miR-143-3p miRNA Info
miRNA Mature AC
MIMAT0000435
Sequence ugagaugaagcacuguagcuc
miRNA Species Homo sapiens
Regulation Mechanism miR-143 might modulate cisplatin resistance of human gastric cancer cell line at least in part by targeting IGF1R. [46]
Evidence Score (E-score) 1 +
1 LacZ Reporter Assay; Western Blot [46]
Representative Target(s) Regulated by This miRNA Apoptosis regulator Bcl-2 (BCL-2) Target Info
BCL2_HUMAN
Connective tissue growth factor (CTGF) Target Info
CTGF_HUMAN
miRNA Mature ID hsa-miR-152-3p miRNA Info
miRNA Mature AC
MIMAT0000438
Sequence ucagugcaugacagaacuugg
miRNA Species Homo sapiens
Regulation Mechanism miR-152 directly targets IGF1R in BC cells. [47]
Evidence Score (E-score) 1 +
1 Luciferase Reporter Assay; Western Blot [47]
Representative Target(s) Regulated by This miRNA Activated leukocyte cell adhesionmolecule (ALCAM) Target Info
CD166_HUMAN
Dickkopf-related protein 1 (DKK1) Target Info
DKK1_HUMAN
miRNA Mature ID hsa-miR-185-5p miRNA Info
miRNA Mature AC
MIMAT0000455
Sequence uggagagaaaggcaguuccuga
miRNA Species Homo sapiens
Regulation Mechanism IGF1R was a miR-185 target. [48]
Evidence Score (E-score) 1 +
1 Luciferase Reporter Assay; Western Blot [48]
Representative Target(s) Regulated by This miRNA Androgen receptor (AR) Target Info
ANDR_HUMAN
Arachidonate 12-lipoxygenase (12-LOX) Target Info
LOX12_HUMAN
miRNA Mature ID hsa-miR-206 miRNA Info
miRNA Mature AC
MIMAT0000462
Sequence uggaauguaaggaagugugugg
miRNA Species Homo sapiens
Regulation Mechanism The anti-metastasis effect of miR-206 is mediated by targeting metastasis regulatory gene IGF1R. [49]
Evidence Score (E-score) 1 +
1 qRT-PCR [49]
Representative Target(s) Regulated by This miRNA Annexin A2 (ANXA2) Target Info
ANXA2_HUMAN
Apoptosis regulator Bcl-2 (BCL-2) Target Info
BCL2_HUMAN
miRNA Mature ID hsa-miR-21-5p miRNA Info
miRNA Mature AC
MIMAT0000076
Sequence uagcuuaucagacugauguuga
miRNA Species Homo sapiens
Regulation Mechanism IGF1R is targeted by miR-21. [50]
Evidence Score (E-score) 1 +
1 Luciferase Reporter Assay [50]
Representative Target(s) Regulated by This miRNA Apoptosis antigen ligand (CD178) Target Info
TNFL6_HUMAN
Apoptosis regulator Bcl-2 (BCL-2) Target Info
BCL2_HUMAN
miRNA Mature ID hsa-miR-214-5p miRNA Info
miRNA Mature AC
MIMAT0004564
Sequence ugccugucuacacuugcugugc
miRNA Species Homo sapiens
Regulation Mechanism miR-214 directly regulates the expression of IGF1R. [51]
Evidence Score (E-score) 1 +
1 Luciferase Reporter Assay [51]
Representative Target(s) Regulated by This miRNA Cellular tumor antigen p53 (TP53) Target Info
P53_HUMAN
Cyclin-dependent kinase 3 (CDK3) Target Info
CDK3_HUMAN
miRNA Mature ID hsa-miR-26b-5p miRNA Info
miRNA Mature AC
MIMAT0000083
Sequence uucaaguaauucaggauaggu
miRNA Species Homo sapiens
Regulation Mechanism IGF1R is targeted by miR-26b. [50]
Evidence Score (E-score) 1 +
1 Luciferase Reporter Assay [50]
Representative Target(s) Regulated by This miRNA ATP-binding cassette transporter A1 (ABCA1) Target Info
ABCA1_HUMAN
Collagen I (COL1A2) Target Info
CO1A2_HUMAN
miRNA Mature ID hsa-miR-376c-3p miRNA Info
miRNA Mature AC
MIMAT0000720
Sequence aacauagaggaaauuccacgu
miRNA Species Homo sapiens
Regulation Mechanism IGF1R as a target of mir-376a. [52]
Evidence Score (E-score) 1 +
1 Luciferase Reporter Assay; Western Blot [52]
Representative Target(s) Regulated by This miRNA Apoptosis regulator Bcl-2 (BCL-2) Target Info
BCL2_HUMAN
Insulin-like growth factor I receptor (IGF1R) Target Info
IGF1R_HUMAN
miRNA Mature ID hsa-miR-383-5p miRNA Info
miRNA Mature AC
MIMAT0000738
Sequence agaucagaaggugauuguggcu
miRNA Species Homo sapiens
Regulation Mechanism Downregulation of miR-383 activated the AKT signaling following upregu- lation of MMP2 expression by directly targeting insulin- like growth factor 1 receptor (IGF1R). [53]
Evidence Score (E-score) 1 +
1 Luciferase Reporter Assay [53]
Representative Target(s) Regulated by This miRNA A proliferation-inducing ligand (APRIL) Target Info
TNF13_HUMAN
G1/S-specific cyclin-D1 (CCND1) Target Info
CCND1_HUMAN
miRNA Mature ID hsa-miR-448 miRNA Info
miRNA Mature AC
MIMAT0001532
Sequence uugcauauguaggaugucccau
miRNA Species Homo sapiens
Regulation Mechanism IGF1R is a direct functional target of miR-448. [54]
Evidence Score (E-score) 1 +
1 Luciferase Reporter Assay; Western Blot [54]
Representative Target(s) Regulated by This miRNA Apoptosis regulator Bcl-2 (BCL-2) Target Info
BCL2_HUMAN
ERK activator kinase 1 (MEK1) Target Info
MP2K1_HUMAN
miRNA Mature ID hsa-miR-150-3p miRNA Info
miRNA Mature AC
MIMAT0004610
Sequence cugguacaggccugggggacag
miRNA Species Homo sapiens
Regulation Mechanism miR-150 overexpression resulted in inhibition of IGF-1R mRNA levels, and decrease in IGF-1R expression. [42]
Evidence Score (E-score) 1 +
1 Luciferase Reporter Assay; Northern Blot; Western Blot [42]
Representative Target(s) Regulated by This miRNA Beta-catenin (CTNNB1) Target Info
CTNB1_HUMAN
Cellular tumor antigen p53 (TP53) Target Info
P53_HUMAN
miRNA Mature ID hsa-miR-15b-3p miRNA Info
miRNA Mature AC
MIMAT0004586
Sequence cgaaucauuauuugcugcucua
miRNA Species Homo sapiens
Regulation Mechanism Ectopic ex-pression of IGF1R repressed the protein expression of IGF1R. [55]
Evidence Score (E-score) 1 +
1 Luciferase Reporter Assay; Western Blot [55]
Representative Target(s) Regulated by This miRNA Cyclin D (CCND3) Target Info
CCND3_HUMAN
Insulin-like growth factor I receptor (IGF1R) Target Info
IGF1R_HUMAN
miRNA Mature ID hsa-miR-223-5p miRNA Info
miRNA Mature AC
MIMAT0004570
Sequence cguguauuugacaagcugaguu
miRNA Species Homo sapiens
Regulation Mechanism IGF1R is targeted by miR-223. [56]
Evidence Score (E-score) 1 +
1 EMSA; Luciferase Reporter Assay; Western Blot [56]
Representative Target(s) Regulated by This miRNA Epidermal growth factor (EGF) Target Info
EGF_HUMAN
F-box and WD-40 domain protein 7 (Fbxw7) Target Info
FBXW7_HUMAN
miRNA Mature ID hsa-miR-7-1-3p miRNA Info
miRNA Mature AC
MIMAT0004553
Sequence caacaaaucacagucugccaua
miRNA Species Homo sapiens
Regulation Mechanism Introduction of miR-7 mimics markedly decreases the expressions of IGF-1R and further suppressed the activation of MAPK and PI3K/AKT pathway. [57]
Evidence Score (E-score) 1 +
1 Western Blot [57]
Representative Target(s) Regulated by This miRNA Epidermal growth factor receptor (EGFR) Target Info
EGFR_HUMAN
Insulin-like growth factor I receptor (IGF1R) Target Info
IGF1R_HUMAN
miRNA Mature ID hsa-miR-885-5p miRNA Info
miRNA Mature AC
MIMAT0004947
Sequence uccauuacacuacccugccucu
miRNA Species Homo sapiens
Regulation Mechanism miR-885-5p is a direct regulator of the IGF1 receptor (IGF1R) responsible for stemness marker expression. [58]
Evidence Score (E-score) 1 +
1 Luciferase Reporter Assay; Western Blot [58]
Representative Target(s) Regulated by This miRNA Beta-catenin (CTNNB1) Target Info
CTNB1_HUMAN
Caspase-3 (CASP3) Target Info
CASP3_HUMAN
miRNA Mature ID hsa-miR-99b-5p miRNA Info
miRNA Mature AC
MIMAT0000689
Sequence cacccguagaaccgaccuugcg
miRNA Species Homo sapiens
Regulation Mechanism Overexpression of miR-99b downregulates IGF-1R expression, and represses the PI3K-AKT signaling pathway. [59]
Evidence Score (E-score) 1 +
1 Luciferase Reporter Assay; Western Blot [59]
Representative Target(s) Regulated by This miRNA Insulin-like growth factor I receptor (IGF1R) Target Info
IGF1R_HUMAN
NADPH oxidase 4 (NOX4) Target Info
NOX4_HUMAN
miRNA Mature ID hsa-miR-125b-2-3p miRNA Info
miRNA Mature AC
MIMAT0004603
Sequence ucacaagucaggcucuugggac
miRNA Species Homo sapiens
Regulation Mechanism IGF1R is a key target molecule regulated by 125b-2. [4]
Evidence Score (E-score) 1 +
1 Luciferase Reporter Assay; Western Blot [4]
Representative Target(s) Regulated by This miRNA Insulin-like growth factor I receptor (IGF1R) Target Info
IGF1R_HUMAN
References  Top
REF 1 Reciprocal regulation of microRNA-99a and insulin-like growth factor I receptor signaling in oral squamous cell carcinoma cells. Mol Cancer. 2014 Jan 10;13:6.
REF 2 Genome-wide screen identified let-7c/miR-99a/miR-125b regulating tumor progression and stem-like properties in cholangiocarcinoma. Oncogene. 2016 Jun 30;35(26):3376-86.
REF 3 MicroRNA-99a inhibits insulin-induced proliferation, migration, dedifferentiation, and rapamycin resistance of vascular smooth muscle cells by inhibiting insulin-like growth factor-1 receptor and mammalian target of rapamycin. Biochem Biophys Res Commun. 2017 Apr 29;486(2):414-422.
REF 4 Regulation of several androgen-induced genes through the repression of the miR-99a/let-7c/miR-125b-2 miRNA cluster in prostate cancer cells. Oncogene. 2014 Mar 13;33(11):1448-57.
REF 5 MicroRNA-99a inhibits hepatocellular carcinoma growth and correlates with prognosis of patients with hepatocellular carcinoma. J Biol Chem. 2011 Oct 21;286(42):36677-85.
REF 6 MiRNA expression in psoriatic skin: reciprocal regulation of hsa-miR-99a and IGF-1R. PLoS One. 2011;6(6):e20916.
REF 7 Regulation of insulin-like growth factor-mammalian target of rapamycin signaling by microRNA in childhood adrenocortical tumors. Cancer Res. 2010 Jun 1;70(11):4666-75.
REF 8 A novel oncogenic mechanism in Ewing sarcoma involving IGF pathway targeting by EWS/Fli1-regulated microRNAs. Oncogene. 2011 Dec 8;30(49):4910-20.
REF 9 MicroRNAs 103 and 107 regulate insulin sensitivity. Nature. 2011 Jun 8;474(7353):649-53.
REF 10 MicroRNA-100/99a, deregulated in acute lymphoblastic leukaemia, suppress proliferation and promote apoptosis by regulating the FKBP51 and IGF1R/mTOR signalling pathways. Br J Cancer. 2013 Oct 15;109(8):2189-98.
REF 11 MicroRNA regulation of mitogenic signaling networks in the human placenta. J Biol Chem. 2014 Oct 31;289(44):30404-16.
REF 12 MicroRNA-145 directly targets the insulin-like growth factor receptor I in human bladder cancer cells. FEBS Lett. 2014 Aug 25;588(17):3180-5.
REF 13 MiR-145 suppresses embryo-epithelial juxtacrine communication at implantation by modulating maternal IGF1R. J Cell Sci. 2015 Feb 15;128(4):804-14.
REF 14 Mechanism of growth inhibition by MicroRNA 145: the role of the IGF-I receptor signaling pathway. J Cell Physiol. 2009 Aug;220(2):485-91.
REF 15 Decoy oligonucleotide rescues IGF1R expression from MicroRNA-223 suppression. PLoS One. 2013 Dec 4;8(12):e82167.
REF 16 MiR-223 suppresses cell proliferation by targeting IGF-1R. PLoS One. 2011;6(11):e27008.
REF 17 Increased miR-223 expression in T cells from patients with rheumatoid arthritis leads to decreased insulin-like growth factor-1-mediated interleukin-10 production. Clin Exp Immunol. 2014 Sep;177(3):641-51.
REF 18 Platelet-secreted microRNA-223 promotes endothelial cell apoptosis induced by advanced glycation end products via targeting the insulin-like growth factor 1 receptor. J Immunol. 2014 Jan 1;192(1):437-46.
REF 19 MiR-139 inhibits invasion and metastasis of colorectal cancer by targeting the type I insulin-like growth factor receptor. Biochem Pharmacol. 2012 Aug 1;84(3):320-30.
REF 20 MicroRNA-139-5p inhibits cell proliferation and invasion by targeting insulin-like growth factor 1 receptor in human non-small cell lung cancer. Int J Clin Exp Pathol. 2015 Apr 1;8(4):3864-70.
REF 21 Post-transcriptional regulation of the tumor suppressor miR-139-5p and a network of miR-139-5p-mediated mRNA interactions in colorectal cancer. FEBS J. 2014 Aug;281(16):3609-24.
REF 22 MiR-122 inhibits cell proliferation and tumorigenesis of breast cancer by targeting IGF1R. PLoS One. 2012;7(10):e47053.
REF 23 MicroRNA-122 inhibits tumorigenic properties of hepatocellular carcinoma cells and sensitizes these cells to sorafenib. J Biol Chem. 2009 Nov 13;284(46):32015-27.
REF 24 Dysregulation of the mitogen granulin in human cancer through the miR-15/107 microRNA gene group. Cancer Res. 2010 Nov 15;70(22):9137-42.
REF 25 Insulin-like growth factor 1 receptor (IGF-1R) as a target of MiR-497 and plasma IGF-1R levels associated with TNM stage of pancreatic cancer. PLoS One. 2014 Mar 25;9(3):e92847.
REF 26 MicroRNA-497 is a potential prognostic marker in human cervical cancer and functions as a tumor suppressor by targeting the insulin-like growth factor 1 receptor. Surgery. 2013 Jun;153(6):836-47.
REF 27 MicroRNA-497 targets insulin-like growth factor 1 receptor and has a tumour suppressive role in human colorectal cancer. Oncogene. 2013 Apr 11;32(15):1910-20.
REF 28 MiR-503 regulates cisplatin resistance of human gastric cancer cell lines by targeting IGF1R and BCL2. Chin Med J (Engl). 2014;127(12):2357-62.
REF 29 MiR-503 inhibits hepatocellular carcinoma cell growth via inhibition of insulin-like growth factor 1 receptor. Onco Targets Ther. 2016 Jun 15;9:3535-44.
REF 30 MicroRNA-503 acts as a tumor suppressor in glioblastoma for multiple antitumor effects by targeting IGF-1R. Oncol Rep. 2014 Mar;31(3):1445-52.
REF 31 Lin28b promotes head and neck cancer progression via modulation of the insulin-like growth factor survival pathway. Oncotarget. 2012 Dec;3(12):1641-52.
REF 32 A quantitative analysis of CLIP methods for identifying binding sites of RNA-binding proteins. Nat Methods. 2011 May 15;8(7):559-64.
REF 33 Upstream and downstream mechanisms for the promoting effects of IGF-1 on differentiation of spermatogonia to primary spermatocytes. Life Sci. 2014 Apr 17;101(1-2):49-55.
REF 34 MicroRNA regulation of neuron-like differentiation of adipose tissue-derived stem cells. Differentiation. 2009 Dec;78(5):253-9.
REF 35 MiR-133b is down-regulated in human osteosarcoma and inhibits osteosarcoma cells proliferation, migration and invasion, and promotes apoptosis. PLoS One. 2013 Dec 31;8(12):e83571.
REF 36 Transcriptome-wide identification of RNA-binding protein and microRNA target sites by PAR-CLIP. Cell. 2010 Apr 2;141(1):129-41.
REF 37 MicroRNA miR-335 is crucial for the BRCA1 regulatory cascade in breast cancer development. Int J Cancer. 2011 Dec 15;129(12):2797-806.
REF 38 MiR-378 controls cardiac hypertrophy by combined repression of mitogen-activated protein kinase pathway factors. Circulation. 2013 May 28;127(21):2097-106.
REF 39 miR-494 inhibits invasion and proliferation of gastric cancer by targeting IGF-1R. Eur Rev Med Pharmacol Sci. 2016 Sep;20(18):3818-3824.
REF 40 miR-494 suppresses tumor growth of epithelial ovarian carcinoma by targeting IGF1R. Tumour Biol. 2016 Jun;37(6):7767-76.
REF 41 miR-630 targets IGF1R to regulate response to HER-targeting drugs and overall cancer cell progression in HER2 over-expressing breast cancer. Mol Cancer. 2014 Mar 24;13:71.
REF 42 Upregulation of miR-150* and miR-630 induces apoptosis in pancreatic cancer cells by targeting IGF-1R. PLoS One. 2013 May 10;8(5):e61015.
REF 43 Regulation of insulin-like growth factor 1 receptor signaling by microRNA-4458 in the development of lumbar disc degeneration. Am J Transl Res. 2016 May 15;8(5):2309-16.
REF 44 miR-140 suppresses tumor growth and metastasis of non-small cell lung cancer by targeting insulin-like growth factor 1 receptor. PLoS One. 2013 Sep 10;8(9):e73604.
REF 45 Anti-proliferative role and prognostic implication of miR-141 in gastric cancer. Am J Transl Res. 2016 Aug 15;8(8):3549-57.
REF 46 Involvement of miR-143 in cisplatin resistance of gastric cancer cells via targeting IGF1R and BCL2. Tumour Biol. 2015 Apr;36(4):2737-45.
REF 47 A regulatory circuit of miR-148a/152 and DNMT1 in modulating cell transformation and tumor angiogenesis through IGF-IR and IRS1. J Mol Cell Biol. 2013 Feb;5(1):3-13.
REF 48 Transgenic expression of microRNA-185 causes a developmental arrest of T cells by targeting multiple genes including Mzb1. J Biol Chem. 2013 Oct 18;288(42):30752-62.
REF 49 MicroRNA-206 suppresses gastric cancer cell growth and metastasis. Cell Biosci. 2014 May 5;4:26.
REF 50 Modulation of microRNAs in hypertension-induced arterial remodeling through the 1 and 3-adrenoreceptor pathways. J Mol Cell Cardiol. 2013 Dec;65:127-36.
REF 51 MicroRNA-214 Reduces Insulin-like Growth Factor-1 (IGF-1) Receptor Expression and Downstream mTORC1 Signaling in Renal Carcinoma Cells. J Biol Chem. 2016 Jul 8;291(28):14662-76.
REF 52 Silencing of a large microRNA cluster on human chromosome 14q32 in melanoma: biological effects of mir-376a and mir-376c on insulin growth factor 1 receptor. Mol Cancer. 2012 Jul 2;11:44.
REF 53 Downregulation of miR-383 promotes glioma cell invasion by targeting insulin-like growth factor 1 receptor. Med Oncol. 2013;30(2):557.
REF 54 miR-448 suppresses proliferation and invasion by regulating IGF1R in colorectal cancer cells. Am J Transl Res. 2016 Jul 15;8(7):3013-22.
REF 55 miR-15b Inhibits the Progression of Glioblastoma Cells Through Targeting Insulin-like Growth Factor Receptor 1. Horm Cancer. 2017 Feb;8(1):49-57.
REF 56 Down-regulation of microRNA-223 promotes degranulation via the PI3K/Akt pathway by targeting IGF-1R in mast cells. PLoS One. 2015 Apr 13;10(4):e0123575.
REF 57 miR-7 reverses the resistance to BRAFi in melanoma by targeting EGFR/IGF-1R/CRAF and inhibiting the MAPK and PI3K/AKT signaling pathways. Oncotarget. 2016 Aug 16;7(33):53558-53570.
REF 58 p73 and IGF1R Regulate Emergence of Aggressive Cancer Stem-like Features via miR-885-5p Control. Cancer Res. 2016 Jan 15;76(2):197-205.
REF 59 miR-99b suppresses IGF-1R expression and contributes to inhibition of cell proliferation in human epidermal keratinocytes. Biomed Pharmacother. 2015 Oct;75:159-64.

If You Find Any Error in Data or Bug in Web Service, Please Kindly Report It to Dr. Zhou and Dr. Zhang.