Target Regulator(s) Information (MicroRNA)

Content Navigation (  All   None )                                      
Target General Information
The microRNAs (miRNAs) Regulating This Target
References
Target General Information  Top
Target ID T31309 Target Info
Target Name Apoptosis regulator Bcl-2 (BCL-2)
Synonyms Bcl-2
Target Type Successful Target
Gene Name BCL2
Biochemical Class B-cell lymphoma Bcl-2
UniProt ID
P10415
The microRNAs (miRNAs) Regulating This Target  Top
miRNA Mature ID hsa-miR-34a-5p miRNA Info
miRNA Mature AC
MIMAT0000255
Sequence uggcagugucuuagcugguugu
miRNA Species Homo sapiens
Regulation Mechanism The overexpression of miR-34a-5p by mature miRNA precursor transfection resulted in the decreased protein level of target BCL2. [4]
Evidence Score (E-score) 14 +
1 Immunoblot; Luciferase Reporter Assay [1]
2 Luciferase Reporter Assay [2]
3 Luciferase Reporter Assay [3]
4 Luciferase Reporter Assay [4]
5 Luciferase Reporter Assay; Microarray; Western Blot [5]
6 Luciferase Reporter Assay; qRT-PCR; Western Blot [6]
7 Luciferase Reporter Assay; qRT-PCR; Western Blot [7]
8 Luciferase Reporter Assay; qRT-PCR; Western Blot [8]
9 Luciferase Reporter Assay; Western Blot; Microarray [9]
10 qRT-PCR; Western Blot [10]
11 qRT-PCR; Western Blot [11]
12 qRT-PCR; Western Blot [12]
13 qRT-PCR; Western Blot; Luciferase Reporter Assay [13]
14 Reporter Assay [14]
Representative Target(s) Regulated by This miRNA Amphiregulin (AREG) Target Info
AREG_HUMAN
Androgen receptor (AR) Target Info
ANDR_HUMAN
miRNA Mature ID hsa-miR-21-5p miRNA Info
miRNA Mature AC
MIMAT0000076
Sequence uagcuuaucagacugauguuga
miRNA Species Homo sapiens
Regulation Mechanism miR-21 regulates Bcl-2 expression via a direct interaction and the mechanism may be associated with phenotypes including apoptosis, chemoresistance and proliferation of MIA PaCa-2 pancreatic cancer cells. [17]
Evidence Score (E-score) 8 +
1 ChIP; Immunofluorescence; Western Blot [15]
2 Luciferase Reporter Assay [16]
3 Luciferase Reporter Assay [17]
4 Luciferase Reporter Assay; Western Blot [18]
5 Luciferase Reporter Assay; Western Blot [19]
6 qRT-PCR; Western Blot [20]
7 Western Blot [21]
8 Western Blot [22]
Representative Target(s) Regulated by This miRNA Apoptosis antigen ligand (CD178) Target Info
TNFL6_HUMAN
Apoptosis regulator Bcl-2 (BCL-2) Target Info
BCL2_HUMAN
miRNA Mature ID hsa-miR-15a-5p miRNA Info
miRNA Mature AC
MIMAT0000068
Sequence uagcagcacauaaugguuugug
miRNA Species Homo sapiens
Regulation Mechanism The overexpression of miR-15a-5p resulted in the decreased mRNA level of target BCL2. [4]
Evidence Score (E-score) 7 +
1 Luciferase Reporter Assay [23]
2 Luciferase Reporter Assay [24]
3 Luciferase Reporter Assay [4]
4 Microarray; qRT-PCR [25]
5 Western Blot [26]
6 Western Blot [27]
7 Western Blot [28]
Representative Target(s) Regulated by This miRNA Amyloid beta A4 protein (APP) Target Info
A4_HUMAN
Apoptosis regulator Bcl-2 (BCL-2) Target Info
BCL2_HUMAN
miRNA Mature ID hsa-miR-204-5p miRNA Info
miRNA Mature AC
MIMAT0000265
Sequence uucccuuugucauccuaugccu
miRNA Species Homo sapiens
Regulation Mechanism miR-204 targets BCL2 and TrkB in neuroblastoma celllines. [30]
Evidence Score (E-score) 6 +
1 Immunohistochemistry; Microarray; qRT-PCR; Western Blot [29]
2 Luciferase Reporter Assay [30]
3 Luciferase Reporter Assay; qRT-PCR; Western Blot [31]
4 Luciferase Reporter Assay; qRT-PCR; Western Blot [32]
5 Luciferase Reporter Assay; Western Blot [33]
6 qRT-PCR; Western Blot [34]
Representative Target(s) Regulated by This miRNA Alkaline phosphatase tissue-nonspecific (ALPL) Target Info
PPBT_HUMAN
Apoptosis regulator Bcl-2 (BCL-2) Target Info
BCL2_HUMAN
miRNA Mature ID hsa-miR-449a miRNA Info
miRNA Mature AC
MIMAT0001541
Sequence uggcaguguauuguuagcuggu
miRNA Species Homo sapiens
Regulation Mechanism BCL2 is a direct MIR449A target. [35]
Evidence Score (E-score) 5 +
1 Luciferase Reporter Assay [35]
2 Luciferase Reporter Assay; qRT-PCR; Western Blot [36]
3 Luciferase Reporter Assay; qRT-PCR; Western Blot [37]
4 qRT-PCR; Western Blot [34]
5 Western Blot [38]
Representative Target(s) Regulated by This miRNA Apoptosis regulator Bcl-2 (BCL-2) Target Info
BCL2_HUMAN
Cyclin-dependent kinase 4 (CDK4) Target Info
CDK4_HUMAN
miRNA Mature ID hsa-miR-143-3p miRNA Info
miRNA Mature AC
MIMAT0000435
Sequence ugagaugaagcacuguagcuc
miRNA Species Homo sapiens
Regulation Mechanism miR-143 may play a role in the pathogenesis of cervical cancer through the regulation of the expression of Bcl-2. [42]
Evidence Score (E-score) 4 +
1 Luciferase Reporter Assay; Microarray; qRT-PCR; Western Blot [39]
2 Luciferase Reporter Assay; qRT-PCR; Western Blot [40]
3 Western Blot [41]
4 Western Blot [42]
Representative Target(s) Regulated by This miRNA Apoptosis regulator Bcl-2 (BCL-2) Target Info
BCL2_HUMAN
Connective tissue growth factor (CTGF) Target Info
CTGF_HUMAN
miRNA Mature ID hsa-miR-15b-5p miRNA Info
miRNA Mature AC
MIMAT0000417
Sequence uagcagcacaucaugguuuaca
miRNA Species Homo sapiens
Regulation Mechanism The overexpression of miR-15b-5p by mature miRNA precursor transfection resulted in the decreased protein level of target BCL2. [4]
Evidence Score (E-score) 4 +
1 Luciferase Reporter Assay; qRT-PCR; Western Blot [43]
2 Luciferase Reporter Assay; qRT-PCR; Western Blot [44]
3 Luciferase Reporter Assay; qRT-PCR; Western Blot [4]
4 qRT-PCR; Western Blot [45]
Representative Target(s) Regulated by This miRNA Apoptosis regulator Bcl-2 (BCL-2) Target Info
BCL2_HUMAN
Checkpoint kinase-1 (CHK1) Target Info
CHK1_HUMAN
miRNA Mature ID hsa-miR-195-5p miRNA Info
miRNA Mature AC
MIMAT0000461
Sequence uagcagcacagaaauauuggc
miRNA Species Homo sapiens
Regulation Mechanism By co-transfection with miR-195 mimic, the luciferase activity of the full length Bcl-2 3'UTR reporter was suppressed, while target site deleted reporter failed to be targeted by miR-195 co-transfection. [47]
Evidence Score (E-score) 3 +
1 Immunohistochemistry; Luciferase Reporter Assay; qRT-PCR; Western Blot [46]
2 Luciferase Reporter Assay; Western Blot [47]
3 qRT-PCR; Western Blot [48]
Representative Target(s) Regulated by This miRNA ADP-ribosylation factor-like protein 2 (ARL2) Target Info
ARL2_HUMAN
Apoptosis inhibitor survivin (BIRC5) Target Info
BIRC5_HUMAN
miRNA Mature ID hsa-miR-205-5p miRNA Info
miRNA Mature AC
MIMAT0000266
Sequence uccuucauuccaccggagucug
miRNA Species Homo sapiens
Regulation Mechanism miR-205 caused reduction in the luciferase signal when the BCL2 UTR was tested. [51]
Evidence Score (E-score) 3 +
1 Immunohistochemistry; qRT-PCR; Western Blot [49]
2 Luciferase Reporter Assay; qRT-PCR; Western Blot [50]
3 Luciferase Reporter Assay; Western Blot [51]
Representative Target(s) Regulated by This miRNA Androgen receptor (AR) Target Info
ANDR_HUMAN
Apoptosis regulator Bcl-2 (BCL-2) Target Info
BCL2_HUMAN
miRNA Mature ID hsa-miR-503-5p miRNA Info
miRNA Mature AC
MIMAT0002874
Sequence uagcagcgggaacaguucugcag
miRNA Species Homo sapiens
Regulation Mechanism hsa-miR-503 modulates cisplatin resistance of human gastric cancer cells by targeting BCL2. [54]
Evidence Score (E-score) 3 +
1 Immunohistochemistry; Luciferase Reporter Assay; qRT-PCR; Western Blot [52]
2 Immunoprecipitation; Luciferase Reporter Assay; qRT-PCR; Western Blot [53]
3 Luciferase Reporter Assay; Western Blot [54]
Representative Target(s) Regulated by This miRNA Apoptosis regulator Bcl-2 (BCL-2) Target Info
BCL2_HUMAN
CD40L receptor (CD40) Target Info
TNR5_HUMAN
miRNA Mature ID hsa-miR-17-5p miRNA Info
miRNA Mature AC
MIMAT0000070
Sequence caaagugcuuacagugcagguag
miRNA Species Homo sapiens
Regulation Mechanism The overexpression of miR-17-5p resulted in the decreased protein level of target BCL2. [4]
Evidence Score (E-score) 3 +
1 Luciferase Reporter Assay [55]
2 Luciferase Reporter Assay; qRT-PCR [4]
3 Luciferase Reporter Assay; qRT-PCR; Western Blot [56]
Representative Target(s) Regulated by This miRNA Amyloid beta A4 protein (APP) Target Info
A4_HUMAN
Apoptosis mediating surface antigen FAS (FAS) Target Info
TNR6_HUMAN
miRNA Mature ID hsa-miR-181c-5p miRNA Info
miRNA Mature AC
MIMAT0000258
Sequence aacauucaaccugucggugagu
miRNA Species Homo sapiens
Regulation Mechanism BCL2 is a target gene of the mature miR-181c. [58]
Evidence Score (E-score) 2 +
1 GFP Reporter Assay; qRT-PCR; Western Blot [57]
2 Luciferase Reporter Assay; Western Blot [58]
Representative Target(s) Regulated by This miRNA Apoptosis regulator Bcl-2 (BCL-2) Target Info
BCL2_HUMAN
Bone morphogenetic protein receptor (BMPR2) Target Info
BMPR2_HUMAN
miRNA Mature ID hsa-miR-192-5p miRNA Info
miRNA Mature AC
MIMAT0000222
Sequence cugaccuaugaauugacagcc
miRNA Species Homo sapiens
Regulation Mechanism 3'UTR from BCL2 was regulated by miR-192 but not by miR-192mut, indicating that these 3'UTR can confer regulation of a heterologous gene by miR-192. [59]
Evidence Score (E-score) 2 +
1 Luciferase Reporter Assay [59]
2 qRT-PCR; Western Blot [60]
Representative Target(s) Regulated by This miRNA Activated leukocyte cell adhesionmolecule (ALCAM) Target Info
CD166_HUMAN
Activin receptor type IIB (ACVR2B) Target Info
AVR2B_HUMAN
miRNA Mature ID hsa-miR-20a-5p miRNA Info
miRNA Mature AC
MIMAT0000075
Sequence uaaagugcuuauagugcagguag
miRNA Species Homo sapiens
Regulation Mechanism The overexpression of miR-20a-5p resulted in the decreased protein level of target BCL2. [4]
Evidence Score (E-score) 2 +
1 Luciferase Reporter Assay [55]
2 Luciferase Reporter Assay; qRT-PCR [4]
Representative Target(s) Regulated by This miRNA Amyloid beta A4 protein (APP) Target Info
A4_HUMAN
Apoptosis regulator Bcl-2 (BCL-2) Target Info
BCL2_HUMAN
miRNA Mature ID hsa-miR-29c-3p miRNA Info
miRNA Mature AC
MIMAT0000681
Sequence uagcaccauuugaaaucgguua
miRNA Species Homo sapiens
Regulation Mechanism BCL2 is Direct Target of miR-29c. [62]
Evidence Score (E-score) 2 +
1 Luciferase Reporter Assay [61]
2 Luciferase Reporter Assay; Western Blot [62]
Representative Target(s) Regulated by This miRNA Apoptosis regulator Bcl-2 (BCL-2) Target Info
BCL2_HUMAN
B7 homolog 3 (CD276) Target Info
CD276_HUMAN
miRNA Mature ID hsa-miR-34b-3p miRNA Info
miRNA Mature AC
MIMAT0004676
Sequence caaucacuaacuccacugccau
miRNA Species Homo sapiens
Evidence Score (E-score) 2 +
1 qRT-PCR; Western Blot [34]
2 qRT-PCR; Western Blot [5]
Representative Target(s) Regulated by This miRNA Apoptosis regulator Bcl-2 (BCL-2) Target Info
BCL2_HUMAN
Cyclic AMP-responsive element-binding protein (CREB1) Target Info
CREB1_HUMAN
miRNA Mature ID hsa-miR-34c-5p miRNA Info
miRNA Mature AC
MIMAT0000686
Sequence aggcaguguaguuagcugauugc
miRNA Species Homo sapiens
Evidence Score (E-score) 2 +
1 Luciferase Reporter Assay; Western Blot [8]
2 qRT-PCR; Western Blot [34]
Representative Target(s) Regulated by This miRNA Apoptosis regulator Bcl-2 (BCL-2) Target Info
BCL2_HUMAN
Cyclin-dependent kinase 4 (CDK4) Target Info
CDK4_HUMAN
miRNA Mature ID hsa-miR-365a-3p miRNA Info
miRNA Mature AC
MIMAT0000710
Sequence uaaugccccuaaaaauccuuau
miRNA Species Homo sapiens
Regulation Mechanism miR-365 targets Bcl-2. [63]
Evidence Score (E-score) 2 +
1 Luciferase Reporter Assay; Western Blot [63]
2 Western Blot [64]
Representative Target(s) Regulated by This miRNA Activin receptor-like kinase 2 (ALK-2) Target Info
ACVR1_HUMAN
Apoptosis regulator Bcl-2 (BCL-2) Target Info
BCL2_HUMAN
miRNA Mature ID hsa-miR-429 miRNA Info
miRNA Mature AC
MIMAT0001536
Sequence uaauacugucugguaaaaccgu
miRNA Species Homo sapiens
Regulation Mechanism miR-429 might play an important role in the development of MDR in human gastric and lung cancer cell lines by targeting the anti-apoptotic gene BCL2. [66]
Evidence Score (E-score) 2 +
1 Luciferase Reporter Assay; qRT-PCR; Western Blot [65]
2 Luciferase Reporter Assay; Western Blot [66]
Representative Target(s) Regulated by This miRNA Apoptosis regulator Bcl-2 (BCL-2) Target Info
BCL2_HUMAN
DNA [cytosine-5]-methyltransferase 1 (DNMT1) Target Info
DNMT1_HUMAN
miRNA Mature ID hsa-miR-497-5p miRNA Info
miRNA Mature AC
MIMAT0002820
Sequence cagcagcacacugugguuugu
miRNA Species Homo sapiens
Regulation Mechanism miR-497 could play a role in gastric cancer cell lines at least in part by modulation of apoptosis via targeting BCL2. [68]
Evidence Score (E-score) 2 +
1 Luciferase Reporter Assay; qRT-PCR; Western Blot [67]
2 Luciferase Reporter Assay; Western Blot [68]
Representative Target(s) Regulated by This miRNA Angiomotin (AMOT) Target Info
AMOT_HUMAN
Apoptosis inhibitor survivin (BIRC5) Target Info
BIRC5_HUMAN
miRNA Mature ID hsa-miR-630 miRNA Info
miRNA Mature AC
MIMAT0003299
Sequence aguauucuguaccagggaaggu
miRNA Species Homo sapiens
Evidence Score (E-score) 2 +
1 Immunoblot; Luciferase Reporter Assay; qRT-PCR [69]
2 Immunoblot; Luciferase Reporter Assay; qRT-PCR [4]
Representative Target(s) Regulated by This miRNA Apoptosis regulator Bcl-2 (BCL-2) Target Info
BCL2_HUMAN
Apoptosis regulator Bcl-W (BCL-W) Target Info
B2CL2_HUMAN
miRNA Mature ID hsa-miR-181d-5p miRNA Info
miRNA Mature AC
MIMAT0002821
Sequence aacauucauuguugucggugggu
miRNA Species Homo sapiens
Regulation Mechanism BCL2 is a target gene of the mature miR-181d. [58]
Evidence Score (E-score) 2 +
1 Immunohistochemistry; Luciferase Reporter Assay; qRT-PCR; Western Blot [70]
2 Luciferase Reporter Assay; Western Blot [58]
Representative Target(s) Regulated by This miRNA Apoptosis regulator Bcl-2 (BCL-2) Target Info
BCL2_HUMAN
GTPase HRas (HRAS) Target Info
RASH_HUMAN
miRNA Mature ID hsa-miR-1-3p miRNA Info
miRNA Mature AC
MIMAT0000416
Sequence uggaauguaaagaaguauguau
miRNA Species Homo sapiens
Regulation Mechanism The overexpression of miR-1-3p resulted in the decreased protein level of target BCL2. [4]
Evidence Score (E-score) 1 +
1 Western Blot; qRT-PCR [4]
Representative Target(s) Regulated by This miRNA Apoptosis regulator Bcl-2 (BCL-2) Target Info
BCL2_HUMAN
Brain-derived neurotrophic factor (BDNF) Target Info
BDNF_HUMAN
miRNA Mature ID hsa-miR-125a-5p miRNA Info
miRNA Mature AC
MIMAT0000443
Sequence ucccugagacccuuuaaccuguga
miRNA Species Homo sapiens
Regulation Mechanism Anti-apoptotic gene BCL2 is a direct target of miR-125a-5p in colon cancer cells. [71]
Evidence Score (E-score) 1 +
1 Luciferase Reporter Assay; Western Blot [71]
Representative Target(s) Regulated by This miRNA Apoptosis regulator BAK (BAK) Target Info
BAK_HUMAN
Apoptosis regulator Bcl-2 (BCL-2) Target Info
BCL2_HUMAN
miRNA Mature ID hsa-miR-126-3p miRNA Info
miRNA Mature AC
MIMAT0000445
Sequence ucguaccgugaguaauaaugcg
miRNA Species Homo sapiens
Regulation Mechanism Expressions of B-Cell Lymphoma 2 is the Direct Targets of miR-126 in SMCs. [72]
Evidence Score (E-score) 1 +
1 In Situ Hybridization; Luciferase Reporter Assay; Northern Blot; Western Blot [72]
Representative Target(s) Regulated by This miRNA Adrenomedullin (ADM) Target Info
ADML_HUMAN
Angiopoietin 1 receptor (TEK) Target Info
TIE2_HUMAN
miRNA Mature ID hsa-miR-139-5p miRNA Info
miRNA Mature AC
MIMAT0000250
Sequence ucuacagugcacgugucuccagu
miRNA Species Homo sapiens
Regulation Mechanism BCL2 as a direct target of miR-139-5p cells in vitro. [73]
Evidence Score (E-score) 1 +
1 Luciferase Reporter Assay; Western Blot [73]
Representative Target(s) Regulated by This miRNA Apoptosis regulator Bcl-2 (BCL-2) Target Info
BCL2_HUMAN
C-X-C chemokine receptor type 4 (CXCR4) Target Info
CXCR4_HUMAN
miRNA Mature ID hsa-miR-148a-3p miRNA Info
miRNA Mature AC
MIMAT0000243
Sequence ucagugcacuacagaacuuugu
miRNA Species Homo sapiens
Regulation Mechanism BCL2 is the direct target for miR-148a. [74]
Evidence Score (E-score) 1 +
1 Luciferase Reporter Assay [74]
Representative Target(s) Regulated by This miRNA Activated leukocyte cell adhesionmolecule (ALCAM) Target Info
CD166_HUMAN
Activin receptor-like kinase 2 (ALK-2) Target Info
ACVR1_HUMAN
miRNA Mature ID hsa-miR-16-1-3p miRNA Info
miRNA Mature AC
MIMAT0004489
Sequence ccaguauuaacugugcugcuga
miRNA Species Homo sapiens
Evidence Score (E-score) 1 +
1 qRT-PCR; Western Blot [75]
Representative Target(s) Regulated by This miRNA Apoptosis regulator Bcl-2 (BCL-2) Target Info
BCL2_HUMAN
G1/S-specific cyclin-D1 (CCND1) Target Info
CCND1_HUMAN
miRNA Mature ID hsa-miR-16-5p miRNA Info
miRNA Mature AC
MIMAT0000069
Sequence uagcagcacguaaauauuggcg
miRNA Species Homo sapiens
Regulation Mechanism The overexpression of miR-16-5p by mature miRNA precursor transfection resulted in the decreased protein level of target BCL2. [4]
Evidence Score (E-score) 1 +
1 Western Blot; qRT-PCR; Luciferase Reporter Assay [4]
Representative Target(s) Regulated by This miRNA Apoptosis regulator Bcl-2 (BCL-2) Target Info
BCL2_HUMAN
Corticotropin-releasing factor binding protein (CRHBP) Target Info
CRHBP_HUMAN
miRNA Mature ID hsa-miR-182-5p miRNA Info
miRNA Mature AC
MIMAT0000259
Sequence uuuggcaaugguagaacucacacu
miRNA Species Homo sapiens
Regulation Mechanism miR-182 directly targets the MITF genes through their 3 UTR, and the binding site of miR-182 on BCL2 3 UTR is required for its suppressive activity. [76]
Evidence Score (E-score) 1 +
1 Luciferase Reporter Assay; Western Blot [76]
Representative Target(s) Regulated by This miRNA Apoptosis regulator Bcl-2 (BCL-2) Target Info
BCL2_HUMAN
Brain-derived neurotrophic factor (BDNF) Target Info
BDNF_HUMAN
miRNA Mature ID hsa-miR-184 miRNA Info
miRNA Mature AC
MIMAT0000454
Sequence uggacggagaacugauaagggu
miRNA Species Homo sapiens
Regulation Mechanism BCL2 IS the direct target of miR-184. [77]
Evidence Score (E-score) 1 +
1 Luciferase Reporter Assay [77]
Representative Target(s) Regulated by This miRNA Apoptosis regulator Bcl-2 (BCL-2) Target Info
BCL2_HUMAN
Platelet-derived growth factor B (PDGFB) Target Info
PDGFB_HUMAN
miRNA Mature ID hsa-miR-18a-5p miRNA Info
miRNA Mature AC
MIMAT0000072
Sequence uaaggugcaucuagugcagauag
miRNA Species Homo sapiens
Evidence Score (E-score) 1 +
1 Luciferase Reporter Assay; Western Blot [56]
Representative Target(s) Regulated by This miRNA Apoptosis mediating surface antigen FAS (FAS) Target Info
TNR6_HUMAN
Apoptosis regulator Bcl-2 (BCL-2) Target Info
BCL2_HUMAN
miRNA Mature ID hsa-miR-196b-5p miRNA Info
miRNA Mature AC
MIMAT0001080
Sequence uagguaguuuccuguuguuggg
miRNA Species Homo sapiens
Regulation Mechanism BCL2 gene is a target of miR-196b. [78]
Evidence Score (E-score) 1 +
1 Immunocytochemistry [78]
Representative Target(s) Regulated by This miRNA Apoptosis mediating surface antigen FAS (FAS) Target Info
TNR6_HUMAN
Apoptosis regulator Bcl-2 (BCL-2) Target Info
BCL2_HUMAN
miRNA Mature ID hsa-miR-200b-3p miRNA Info
miRNA Mature AC
MIMAT0000318
Sequence uaauacugccugguaaugauga
miRNA Species Homo sapiens
Regulation Mechanism miR-200b might play an important role in the development of MDR in human gastric and lung cancer cell lines by targeting the anti-apoptotic gene BCL2. [66]
Evidence Score (E-score) 1 +
1 Luciferase Reporter Assay; Western Blot [66]
Representative Target(s) Regulated by This miRNA Apoptosis regulator Bcl-2 (BCL-2) Target Info
BCL2_HUMAN
CDK inhibitor 1B p27Kip1 (CDKN1B) Target Info
CDN1B_HUMAN
miRNA Mature ID hsa-miR-200c-3p miRNA Info
miRNA Mature AC
MIMAT0000617
Sequence uaauacugccggguaaugaugga
miRNA Species Homo sapiens
Regulation Mechanism miR-200c might play an important role in the development of MDR in human gastric and lung cancer cell lines by targeting the anti-apoptotic gene BCL2. [66]
Evidence Score (E-score) 1 +
1 Luciferase Reporter Assay; Western Blot [66]
Representative Target(s) Regulated by This miRNA Activin receptor type IIB (ACVR2B) Target Info
AVR2B_HUMAN
Apoptosis regulator Bcl-2 (BCL-2) Target Info
BCL2_HUMAN
miRNA Mature ID hsa-miR-206 miRNA Info
miRNA Mature AC
MIMAT0000462
Sequence uggaauguaaggaagugugugg
miRNA Species Homo sapiens
Regulation Mechanism The anti-metastasis effect of miR-206 is mediated by targeting BCL2. [79]
Evidence Score (E-score) 1 +
1 qRT-PCR [79]
Representative Target(s) Regulated by This miRNA Annexin A2 (ANXA2) Target Info
ANXA2_HUMAN
Apoptosis regulator Bcl-2 (BCL-2) Target Info
BCL2_HUMAN
miRNA Mature ID hsa-miR-211-5p miRNA Info
miRNA Mature AC
MIMAT0000268
Sequence uucccuuugucauccuucgccu
miRNA Species Homo sapiens
Evidence Score (E-score) 1 +
1 qRT-PCR; Western Blot [34]
Representative Target(s) Regulated by This miRNA Apoptosis regulator Bcl-2 (BCL-2) Target Info
BCL2_HUMAN
Calcium-activated potassium channel KCa1.1 (KCNMA1) Target Info
KCMA1_HUMAN
miRNA Mature ID hsa-miR-224-5p miRNA Info
miRNA Mature AC
MIMAT0000281
Sequence ucaagucacuagugguuccguuuag
miRNA Species Homo sapiens
Regulation Mechanism Overexpression of miR-224 was associated with significant upregulation of BCL-2. [80]
Evidence Score (E-score) 1 +
1 Western Blot [80]
Representative Target(s) Regulated by This miRNA APJ endogenous ligand (Apelin) Target Info
APEL_HUMAN
Apoptosis regulator Bcl-2 (BCL-2) Target Info
BCL2_HUMAN
miRNA Mature ID hsa-miR-26a-1-3p miRNA Info
miRNA Mature AC
MIMAT0004499
Sequence ccuauucuugguuacuugcacg
miRNA Species Homo sapiens
Regulation Mechanism miR-26a transfection can lead to BCL-2 downregulation. [81]
Evidence Score (E-score) 1 +
1 qRT-PCR; Western Blot [81]
Representative Target(s) Regulated by This miRNA Apoptosis regulator Bcl-2 (BCL-2) Target Info
BCL2_HUMAN
Caspase-3 (CASP3) Target Info
CASP3_HUMAN
miRNA Mature ID hsa-miR-296-5p miRNA Info
miRNA Mature AC
MIMAT0000690
Sequence agggcccccccucaauccugu
miRNA Species Homo sapiens
Regulation Mechanism The downregulation of miR-296-5p resulted in the changed protein level of target BCL2. [4]
Evidence Score (E-score) 1 +
1 Western Blot; qRT-PCR [4]
Representative Target(s) Regulated by This miRNA Apoptosis regulator Bcl-2 (BCL-2) Target Info
BCL2_HUMAN
Bcl-2-binding component 3 (BBC3) Target Info
BBC3_HUMAN
miRNA Mature ID hsa-miR-29a-3p miRNA Info
miRNA Mature AC
MIMAT0000086
Sequence uagcaccaucugaaaucgguua
miRNA Species Homo sapiens
Regulation Mechanism BCL2 is direct target of miR-29a. [62]
Evidence Score (E-score) 1 +
1 Luciferase Reporter Assay; Western Blot [62]
Representative Target(s) Regulated by This miRNA Apoptosis regulator Bcl-2 (BCL-2) Target Info
BCL2_HUMAN
Aryl hydrocarbon receptor (AHR) Target Info
AHR_HUMAN
miRNA Mature ID hsa-miR-30b-5p miRNA Info
miRNA Mature AC
MIMAT0000420
Sequence uguaaacauccuacacucagcu
miRNA Species Homo sapiens
Evidence Score (E-score) 1 +
1 Luciferase Reporter Assay [82]
Representative Target(s) Regulated by This miRNA Apoptosis regulator Bcl-2 (BCL-2) Target Info
BCL2_HUMAN
Beclin-1 (BECN1) Target Info
BECN1_HUMAN
miRNA Mature ID hsa-miR-33b-5p miRNA Info
miRNA Mature AC
MIMAT0003301
Sequence gugcauugcuguugcauugc
miRNA Species Homo sapiens
Evidence Score (E-score) 1 +
1 qRT-PCR; Western Blot [8]
Representative Target(s) Regulated by This miRNA Apoptosis regulator Bcl-2 (BCL-2) Target Info
BCL2_HUMAN
ATP-binding cassette transporter A1 (ABCA1) Target Info
ABCA1_HUMAN
miRNA Mature ID hsa-miR-34a-3p miRNA Info
miRNA Mature AC
MIMAT0004557
Sequence caaucagcaaguauacugcccu
miRNA Species Homo sapiens
Regulation Mechanism A negative regulatory effect of miR-34a-3p on BCL2 is via binding to its 3'UTR. [83]
Evidence Score (E-score) 1 +
1 Luciferase Reporter Assay [83]
Representative Target(s) Regulated by This miRNA Apoptosis regulator Bcl-2 (BCL-2) Target Info
BCL2_HUMAN
Beta-catenin (CTNNB1) Target Info
CTNB1_HUMAN
miRNA Mature ID hsa-miR-34b-5p miRNA Info
miRNA Mature AC
MIMAT0000685
Sequence uaggcagugucauuagcugauug
miRNA Species Homo sapiens
Evidence Score (E-score) 1 +
1 Luciferase Reporter Assay; Western Blot [8]
Representative Target(s) Regulated by This miRNA Apoptosis regulator Bcl-2 (BCL-2) Target Info
BCL2_HUMAN
Beta-catenin (CTNNB1) Target Info
CTNB1_HUMAN
miRNA Mature ID hsa-miR-376c-3p miRNA Info
miRNA Mature AC
MIMAT0000720
Sequence aacauagaggaaauuccacgu
miRNA Species Homo sapiens
Evidence Score (E-score) 1 +
1 Western Blot [84]
Representative Target(s) Regulated by This miRNA Apoptosis regulator Bcl-2 (BCL-2) Target Info
BCL2_HUMAN
Insulin-like growth factor I receptor (IGF1R) Target Info
IGF1R_HUMAN
miRNA Mature ID hsa-miR-448 miRNA Info
miRNA Mature AC
MIMAT0001532
Sequence uugcauauguaggaugucccau
miRNA Species Homo sapiens
Evidence Score (E-score) 1 +
1 qRT-PCR; Western Blot [34]
Representative Target(s) Regulated by This miRNA Apoptosis regulator Bcl-2 (BCL-2) Target Info
BCL2_HUMAN
ERK activator kinase 1 (MEK1) Target Info
MP2K1_HUMAN
miRNA Mature ID hsa-miR-451a miRNA Info
miRNA Mature AC
MIMAT0001631
Sequence aaaccguuaccauuacugaguu
miRNA Species Homo sapiens
Evidence Score (E-score) 1 +
1 qRT-PCR; Western Blot [85]
Representative Target(s) Regulated by This miRNA Apoptosis regulator Bcl-2 (BCL-2) Target Info
BCL2_HUMAN
Extracellular signal-regulated kinase 2 (ERK2) Target Info
MK01_HUMAN
miRNA Mature ID hsa-miR-494-3p miRNA Info
miRNA Mature AC
MIMAT0002816
Sequence ugaaacauacacgggaaaccuc
miRNA Species Homo sapiens
Evidence Score (E-score) 1 +
1 qRT-PCR; Western Blot [34]
Representative Target(s) Regulated by This miRNA Apoptosis inhibitor survivin (BIRC5) Target Info
BIRC5_HUMAN
Apoptosis regulator Bcl-2 (BCL-2) Target Info
BCL2_HUMAN
miRNA Mature ID hsa-miR-708-5p miRNA Info
miRNA Mature AC
MIMAT0004926
Sequence aaggagcuuacaaucuagcuggg
miRNA Species Homo sapiens
Regulation Mechanism The overexpression of miR-708 reduced the expression of Bcl2 in A172 and T98G cells. [86]
Evidence Score (E-score) 1 +
1 Western Blot [86]
Representative Target(s) Regulated by This miRNA Apoptosis inhibitor survivin (BIRC5) Target Info
BIRC5_HUMAN
Apoptosis regulator Bcl-2 (BCL-2) Target Info
BCL2_HUMAN
miRNA Mature ID hsa-miR-98-5p miRNA Info
miRNA Mature AC
MIMAT0000096
Sequence ugagguaguaaguuguauuguu
miRNA Species Homo sapiens
Evidence Score (E-score) 1 +
1 Luciferase Reporter Assay; Western Blot [87]
Representative Target(s) Regulated by This miRNA Apoptosis regulator Bcl-2 (BCL-2) Target Info
BCL2_HUMAN
Aromatase (CYP19A1) Target Info
CP19A_HUMAN
miRNA Mature ID hsa-miR-136-5p miRNA Info
miRNA Mature AC
MIMAT0000448
Sequence acuccauuuguuuugaugaugga
miRNA Species Homo sapiens
Regulation Mechanism miR-136 directly targets Bcl-2. [88]
Evidence Score (E-score) 1 +
1 Luciferase Reporter Assay [88]
Representative Target(s) Regulated by This miRNA Apoptosis regulator Bcl-2 (BCL-2) Target Info
BCL2_HUMAN
Interleukin-6 (IL6) Target Info
IL6_HUMAN
miRNA Mature ID hsa-miR-153-3p miRNA Info
miRNA Mature AC
MIMAT0000439
Sequence uugcauagucacaaaagugauc
miRNA Species Homo sapiens
Regulation Mechanism The overexpression of miR-153-3p resulted in the decreased protein level of target BCL2. [4]
Evidence Score (E-score) 1 +
1 Western Blot; qRT-PCR; Luciferase Reporter Assay [4]
Representative Target(s) Regulated by This miRNA Apoptosis regulator Bcl-2 (BCL-2) Target Info
BCL2_HUMAN
Forkhead box protein O1A (FOXO1) Target Info
FOXO1_HUMAN
miRNA Mature ID hsa-miR-15a-3p miRNA Info
miRNA Mature AC
MIMAT0004488
Sequence caggccauauugugcugccuca
miRNA Species Homo sapiens
Evidence Score (E-score) 1 +
1 qRT-PCR; Western Blot [75]
Representative Target(s) Regulated by This miRNA Apoptosis regulator Bcl-2 (BCL-2) Target Info
BCL2_HUMAN
Mixed lineage kinase 1 (MAP3K9) Target Info
M3K9_HUMAN
miRNA Mature ID hsa-miR-181a-5p miRNA Info
miRNA Mature AC
MIMAT0000256
Sequence aacauucaacgcugucggugagu
miRNA Species Homo sapiens
Regulation Mechanism The overexpression of miR-181a-5p by mature miRNA mimics tranfection resulted in the decreased protein level of target BCL2. [4]
Evidence Score (E-score) 1 +
1 Western Blot [4]
Representative Target(s) Regulated by This miRNA Apoptosis regulator Bcl-2 (BCL-2) Target Info
BCL2_HUMAN
CDK inhibitor 1B p27Kip1 (CDKN1B) Target Info
CDN1B_HUMAN
miRNA Mature ID hsa-miR-1284 miRNA Info
miRNA Mature AC
MIMAT0005941
Sequence ucuauacagacccuggcuuuuc
miRNA Species Homo sapiens
Evidence Score (E-score) 1 +
1 qRT-PCR; Western Blot [89]
Representative Target(s) Regulated by This miRNA Apoptosis regulator Bcl-2 (BCL-2) Target Info
BCL2_HUMAN
miRNA Mature ID hsa-miR-1915-3p miRNA Info
miRNA Mature AC
MIMAT0007892
Sequence ccccagggcgacgcggcggg
miRNA Species Homo sapiens
Regulation Mechanism miR-1915 directly inhibit Bcl-2 expression at posttranscriptional level through its 3'UTR. [90]
Evidence Score (E-score) 1 +
1 Luciferase Reporter Assay; Western Blot [90]
Representative Target(s) Regulated by This miRNA Apoptosis regulator Bcl-2 (BCL-2) Target Info
BCL2_HUMAN
miRNA Mature ID hsa-miR-24-2-5p miRNA Info
miRNA Mature AC
MIMAT0004497
Sequence ugccuacugagcugaaacacag
miRNA Species Homo sapiens
Regulation Mechanism Luciferase expression in MCF-7 cells overexpressing miR-24-2 and transfected with pGL3 control vector or vector harboring the predicted miR-24-2 binding site present in 3 'UTR of H2AFX/BCL-2 genes. [91]
Evidence Score (E-score) 1 +
1 Luciferase Reporter Assay [91]
Representative Target(s) Regulated by This miRNA Apoptosis regulator Bcl-2 (BCL-2) Target Info
BCL2_HUMAN
References  Top
REF 1 MicroRNA-34a perturbs B lymphocyte development by repressing the forkhead box transcription factor Foxp1. Immunity. 2010 Jul 23;33(1):48-59.
REF 2 MicroRNA-34a targets Bcl-2 and sensitizes human hepatocellular carcinoma cells to sorafenib treatment. Technol Cancer Res Treat. 2014 Feb;13(1):77-86.
REF 3 The miR-34 family in cancer and apoptosis. Cell Death Differ. 2010 Feb;17(2):193-9.
REF 4 miR-15 and miR-16 induce apoptosis by targeting BCL2. Proc Natl Acad Sci U S A. 2005 Sep 27;102(39):13944-9.
REF 5 p53-mediated activation of miRNA34 candidate tumor-suppressor genes. Curr Biol. 2007 Aug 7;17(15):1298-307.
REF 6 MiR-34a promotes Fas-mediated cartilage endplate chondrocyte apoptosis by targeting Bcl-2. Mol Cell Biochem. 2015 Aug;406(1-2):21-30.
REF 7 miR-34a, a microRNA up-regulated in a double transgenic mouse model of Alzheimer's disease, inhibits bcl2 translation. Brain Res Bull. 2009 Oct 28;80(4-5):268-73.
REF 8 Restoration of tumor suppressor miR-34 inhibits human p53-mutant gastric cancer tumorspheres. BMC Cancer. 2008 Sep 21;8:266.
REF 9 microRNAs join the p53 network--another piece in the tumour-suppression puzzle. Nat Rev Cancer. 2007 Nov;7(11):819-22.
REF 10 MiR-34a, a promising novel biomarker for benzene toxicity, is involved in cell apoptosis triggered by 1,4-benzoquinone through targeting Bcl-2. Environ Pollut. 2017 Feb;221:256-265.
REF 11 Aptamer-Dendrimer Bioconjugates for Targeted Delivery of miR-34a Expressing Plasmid and Antitumor Effects in Non-Small Cell Lung Cancer Cells. PLoS One. 2015 Sep 25;10(9):e0139136.
REF 12 Hyaluronic acid-chitosan nanoparticles for co-delivery of MiR-34a and doxorubicin in therapy against triple negative breast cancer. Biomaterials. 2014 May;35(14):4333-44.
REF 13 A functional screen identifies miR-34a as a candidate neuroblastoma tumor suppressor gene. Mol Cancer Res. 2008 May;6(5):735-42.
REF 14 miRNA-34a is associated with docetaxel resistance in human breast cancer cells. Breast Cancer Res Treat. 2012 Jan;131(2):445-54.
REF 15 Hyaluronan-CD44 interaction promotes c-Jun signaling and miRNA21 expression leading to Bcl-2 expression and chemoresistance in breast cancer cells. Mol Cancer. 2014 Mar 8;13:52.
REF 16 Inductive microRNA-21 impairs anti-mycobacterial responses by targeting IL-12 and Bcl-2. FEBS Lett. 2012 Jul 30;586(16):2459-67.
REF 17 miR-21-mediated tumor growth. Oncogene. 2007 Apr 26;26(19):2799-803.
REF 18 Regulation of NF-B signaling by oxidized glycerophospholipid and IL-1 induced miRs-21-3p and -27a-5p in human aortic endothelial cells. J Lipid Res. 2015 Jan;56(1):38-50.
REF 19 Bcl-2 upregulation induced by miR-21 via a direct interaction is associated with apoptosis and chemoresistance in MIA PaCa-2 pancreatic cancer cells. Arch Med Res. 2011 Jan;42(1):8-14.
REF 20 MicroRNA-21 inhibitor sensitizes human glioblastoma U251 stem cells to chemotherapeutic drug temozolomide. J Mol Neurosci. 2012 Jun;47(2):346-56.
REF 21 microRNA-21 modulates cell proliferation and sensitivity to doxorubicin in bladder cancer cells. Oncol Rep. 2011 Jun;25(6):1721-9.
REF 22 Downregulation of miR-21 inhibits EGFR pathway and suppresses the growth of human glioblastoma cells independent of PTEN status. Lab Invest. 2010 Feb;90(2):144-55.
REF 23 Transcriptome-wide prediction of miRNA targets in human and mouse using FASTH. PLoS One. 2009 May 29;4(5):e5745.
REF 24 The role of microRNA and other non-coding RNA in the pathogenesis of chronic lymphocytic leukemia. Best Pract Res Clin Haematol. 2007 Sep;20(3):425-37.
REF 25 MicroRNA gene expression during retinoic acid-induced differentiation of human acute promyelocytic leukemia. Oncogene. 2007 Jun 14;26(28):4148-57.
REF 26 E2F7 overexpression leads to tamoxifen resistance in breast cancer cells by competing with E2F1 at miR-15a/16 promoter. Oncotarget. 2015 Oct 13;6(31):31944-57.
REF 27 Oncogenic HER2{Delta}16 suppresses miR-15a/16 and deregulates BCL-2 to promote endocrine resistance of breast tumors. Carcinogenesis. 2010 Dec;31(12):2049-57.
REF 28 MiR-15a and MiR-16 control Bmi-1 expression in ovarian cancer. Cancer Res. 2009 Dec 1;69(23):9090-5.
REF 29 miR-204 targets Bcl-2 expression and enhances responsiveness of gastric cancer. Cell Death Dis. 2012 Nov 15;3:e423.
REF 30 MicroRNA microarray identifies Let-7i as a novel biomarker and therapeutic target in human epithelial ovarian cancer. Cancer Res. 2008 Dec 15;68(24):10307-14.
REF 31 Tumor suppressor miRNA-204-5p promotes apoptosis by targeting BCL2 in prostate cancer cells. Asian J Surg. 2017 Sep;40(5):396-406.
REF 32 MicroRNA-204 increases sensitivity of neuroblastoma cells to cisplatin and is associated with a favourable clinical outcome. Br J Cancer. 2012 Sep 4;107(6):967-76.
REF 33 miR-204-5p acts as a tumor suppressor by targeting matrix metalloproteinases-9 and B-cell lymphoma-2 in malignant melanoma. Onco Targets Ther. 2017 Feb 27;10:1237-1246.
REF 34 The changes of miRNA expression in rat hippocampus following chronic lead exposure. Toxicol Lett. 2014 Aug 17;229(1):158-66.
REF 35 EVI1-mediated down regulation of MIR449A is essential for the survival of EVI1 positive leukaemic cells. Br J Haematol. 2011 Aug;154(3):337-48.
REF 36 microRNA-449a functions as a tumor-suppressor in gastric adenocarcinoma by targeting Bcl-2. Oncol Lett. 2013 Dec;6(6):1713-1718.
REF 37 miR-449a Regulates proliferation and chemosensitivity to cisplatin by targeting cyclin D1 and BCL2 in SGC7901 cells. Dig Dis Sci. 2014 Feb;59(2):336-45.
REF 38 MiR-449a regulates autophagy to inhibit silica-induced pulmonary fibrosis through targeting Bcl2. J Mol Med (Berl). 2016 Nov;94(11):1267-1279.
REF 39 miR-143 is downregulated in cervical cancer and promotes apoptosis and inhibits tumor formation by targeting Bcl-2. Mol Med Rep. 2012 Mar;5(3):753-60.
REF 40 Involvement of miR-143 in cisplatin resistance of gastric cancer cells via targeting IGF1R and BCL2. Tumour Biol. 2015 Apr;36(4):2737-45.
REF 41 MicroRNA-143 functions as a tumor suppressor in human esophageal squamous cell carcinoma. Gene. 2013 Apr 1;517(2):197-204.
REF 42 MicroRNA-143 reduces viability and increases sensitivity to 5-fluorouracil in HCT116 human colorectal cancer cells. FEBS J. 2009 Nov;276(22):6689-700.
REF 43 Anti-cancer activity of DHA on gastric cancer--an in vitro and in vivo study. Tumour Biol. 2013 Dec;34(6):3791-800.
REF 44 miR-15b and miR-16 modulate multidrug resistance by targeting BCL2 in human gastric cancer cells. Int J Cancer. 2008 Jul 15;123(2):372-379.
REF 45 MiR-15b mediates liver cancer cells proliferation through targeting BCL-2. Int J Clin Exp Pathol. 2015 Dec 1;8(12):15677-83.
REF 46 Prognostic implications of micoRNA miR-195 expression in human tongue squamous cell carcinoma. PLoS One. 2013;8(2):e56634.
REF 47 microRNA-195 promotes apoptosis and suppresses tumorigenicity of human colorectal cancer cells. Biochem Biophys Res Commun. 2010 Sep 17;400(2):236-40.
REF 48 Study on the molecular regulatory mechanism of MicroRNA-195 in the invasion and metastasis of colorectal carcinoma. Int J Clin Exp Med. 2015 Mar 15;8(3):3793-800.
REF 49 MicroRNA-205 suppresses proliferation and promotes apoptosis in laryngeal squamous cell carcinoma. Med Oncol. 2014 Jan;31(1):785.
REF 50 MicroRNA-205 suppresses the growth of adrenocortical carcinoma SW-13 cells via targeting Bcl-2. Oncol Rep. 2015 Dec;34(6):3104-10.
REF 51 MicroRNA-205, a novel regulator of the anti-apoptotic protein Bcl2, is downregulated in prostate cancer. Int J Oncol. 2013 Jul;43(1):307-14.
REF 52 MiR-503 regulates cisplatin resistance of human gastric cancer cell lines by targeting IGF1R and BCL2. Chin Med J (Engl). 2014;127(12):2357-62.
REF 53 Hepatitis C Virus Nonstructural 5A Protein (HCV-NS5A) Inhibits Hepatocyte Apoptosis through the NF-b/miR-503/bcl-2 Pathway. Mol Cells. 2017 Mar;40(3):202-210.
REF 54 miR-503 regulates the resistance of non-small cell lung cancer cells to cisplatin by targeting Bcl-2. Int J Mol Med. 2013 Sep;32(3):593-8.
REF 55 Down-regulation of miR-17 family expression in response to retinoic acid induced neuronal differentiation. Cell Signal. 2009 Dec;21(12):1837-45.
REF 56 Differential expression of miR-17~92 identifies BCL2 as a therapeutic target in BCR-ABL-positive B-lineage acute lymphoblastic leukemia. Leukemia. 2014 Mar;28(3):554-65.
REF 57 MicroRNA-181c targets Bcl-2 and regulates mitochondrial morphology in myocardial cells. J Cell Mol Med. 2015 Sep;19(9):2084-97.
REF 58 miR-181b modulates multidrug resistance by targeting BCL2 in human cancer cell lines. Int J Cancer. 2010 Dec 1;127(11):2520-9.
REF 59 Coordinated regulation of cell cycle transcripts by p53-Inducible microRNAs, miR-192 and miR-215. Cancer Res. 2008 Dec 15;68(24):10105-12.
REF 60 MicroRNA 192 regulates chemo-resistance of lung adenocarcinoma for gemcitabine and cisplatin combined therapy by targeting Bcl-2. Int J Clin Exp Med. 2015 Aug 15;8(8):12397-403.
REF 61 miR-29b and miR-29c are involved in Toll-like receptor control of glucocorticoid-induced apoptosis in human plasmacytoid dendritic cells. PLoS One. 2013 Jul 23;8(7):e69926.
REF 62 Effects of microRNA-29 on apoptosis, tumorigenicity, and prognosis of hepatocellular carcinoma. Hepatology. 2010 Mar;51(3):836-45.
REF 63 microRNA-365, down-regulated in colon cancer, inhibits cell cycle progression and promotes apoptosis of colon cancer cells by probably targeting Cyclin D1 and Bcl-2. Carcinogenesis. 2012 Jan;33(1):220-5.
REF 64 MicroRNAs expression in ox-LDL treated HUVECs: MiR-365 modulates apoptosis and Bcl-2 expression. Biochem Biophys Res Commun. 2011 Jun 24;410(1):127-33.
REF 65 MiR-429 Induces Gastric Carcinoma Cell Apoptosis Through Bcl-2. Cell Physiol Biochem. 2015;37(4):1572-80.
REF 66 miR-200bc/429 cluster modulates multidrug resistance of human cancer cell lines by targeting BCL2 and XIAP. Cancer Chemother Pharmacol. 2012 Mar;69(3):723-31.
REF 67 MicroRNA-497 induces cell apoptosis by negatively regulating Bcl-2 protein expression at the posttranscriptional level in human breast cancer. Int J Clin Exp Pathol. 2015 Jul 1;8(7):7729-39.
REF 68 miR-497 modulates multidrug resistance of human cancer cell lines by targeting BCL2. Med Oncol. 2012 Mar;29(1):384-91.
REF 69 Phospho-Np63 is a key regulator of the cisplatin-induced microRNAome in cancer cells. Cell Death Differ. 2011 Jul;18(7):1220-30.
REF 70 MiR-181d acts as a tumor suppressor in glioma by targeting K-ras and Bcl-2. J Cancer Res Clin Oncol. 2012 Apr;138(4):573-84.
REF 71 miR-125a-5p inhibits cell proliferation and induces apoptosis in colon cancer via targeting BCL2, BCL2L12 and MCL1. Biomed Pharmacother. 2015 Oct;75:129-36.
REF 72 Regulation of vascular smooth muscle cell turnover by endothelial cell-secreted microRNA-126: role of shear stress. Circ Res. 2013 Jun 21;113(1):40-51.
REF 73 miR-139-5p Inhibits the Epithelial-Mesenchymal Transition and Enhances the Chemotherapeutic Sensitivity of Colorectal Cancer Cells by Downregulating BCL2. Sci Rep. 2016 May 31;6:27157.
REF 74 MiR-148a promotes apoptosis by targeting Bcl-2 in colorectal cancer. Cell Death Differ. 2011 Nov;18(11):1702-10.
REF 75 MiR-15a/16 regulates the growth of myeloma cells, angiogenesis and antitumor immunity by inhibiting Bcl-2, VEGF-A and IL-17 expression in multiple myeloma. Leuk Res. 2016 Oct;49:73-9.
REF 76 Role of microRNA-182 in posterior uveal melanoma: regulation of tumor development through MITF, BCL2 and cyclin D2. PLoS One. 2012;7(7):e40967.
REF 77 Tumor suppressor PDCD4 modulates miR-184-mediated direct suppression of C-MYC and BCL2 blocking cell growth and survival in nasopharyngeal carcinoma. Cell Death Dis. 2013 Oct 24;4:e872.
REF 78 miR-196b targets c-myc and Bcl-2 expression, inhibits proliferation and induces apoptosis in endometriotic stromal cells. Hum Reprod. 2013 Mar;28(3):750-61.
REF 79 MicroRNA-206 suppresses gastric cancer cell growth and metastasis. Cell Biosci. 2014 May 5;4:26.
REF 80 Involvement of microRNA-224 in cell proliferation, migration, invasion, and anti-apoptosis in hepatocellular carcinoma. J Gastroenterol Hepatol. 2013 Mar;28(3):565-75.
REF 81 The Antitumor Effect of Metformin Is Mediated by miR-26a in Breast Cancer. Int J Mol Sci. 2016 Aug 10;17(8). pii: E1298.
REF 82 NF-B-mediated miR-30b regulation in cardiomyocytes cell death by targeting Bcl-2. Mol Cell Biochem. 2014 Feb;387(1-2):135-41.
REF 83 MiR-34a-3p alters proliferation and apoptosis of meningioma cells in vitro and is directly targeting SMAD4, FRAT1 and BCL2. Aging (Albany NY). 2017 Mar 23;9(3):932-954.
REF 84 hsa-miR-376c-3p Regulates Gastric Tumor Growth Both In Vitro and In Vivo. Biomed Res Int. 2016;2016:9604257.
REF 85 MiRNA-451 plays a role as tumor suppressor in human glioma cells. Brain Res. 2010 Nov 4;1359:14-21.
REF 86 miR-708 acts as a tumor suppressor in human glioblastoma cells. Oncol Rep. 2013 Aug;30(2):870-6.
REF 87 Upregulation of microRNA-98 increases radiosensitivity in esophageal squamous cell carcinoma. J Radiat Res. 2016 Sep;57(5):468-476.
REF 88 MiR-136 promotes apoptosis of glioma cells by targeting AEG-1 and Bcl-2. FEBS Lett. 2012 Oct 19;586(20):3608-12.
REF 89 MicroRNA-1284 inhibits proliferation and induces apoptosis in SGC-7901 human gastric cancer cells. Biotechnol Lett. 2017 Jan;39(1):33-38.
REF 90 miR-1915 inhibits Bcl-2 to modulate multidrug resistance by increasing drug-sensitivity in human colorectal carcinoma cells. Mol Carcinog. 2013 Jan;52(1):70-8.
REF 91 miR-24-2 controls H2AFX expression regardless of gene copy number alteration and induces apoptosis by targeting antiapoptotic gene BCL-2: a potential for therapeutic intervention. Breast Cancer Res. 2011 Apr 4;13(2):R39.

If You Find Any Error in Data or Bug in Web Service, Please Kindly Report It to Dr. Zhou and Dr. Zhang.